Transcript: Human XM_006724661.2

PREDICTED: Homo sapiens phosphorylase kinase regulatory subunit alpha 1 (PHKA1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHKA1 (5255)
Length:
5826
CDS:
144..3638

Additional Resources:

NCBI RefSeq record:
XM_006724661.2
NBCI Gene record:
PHKA1 (5255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194762 CAAGCTGATATCCTCTATATG pLKO.1 2301 CDS 100% 13.200 18.480 N PHKA1 n/a
2 TRCN0000322015 GTTCGTCCCACTGATTCAAAT pLKO_005 2883 CDS 100% 13.200 18.480 N Phka1 n/a
3 TRCN0000342713 GTTCGTCCCACTGATTCAAAT pLKO_005 2883 CDS 100% 13.200 18.480 N PHKA1 n/a
4 TRCN0000006188 GCTATTTCTATCCACGAGATT pLKO.1 2913 CDS 100% 4.950 6.930 N PHKA1 n/a
5 TRCN0000199840 CGGTTGATTGTGCATGGAACT pLKO.1 3689 3UTR 100% 4.050 5.670 N PHKA1 n/a
6 TRCN0000342703 CGGTTGATTGTGCATGGAACT pLKO_005 3689 3UTR 100% 4.050 5.670 N PHKA1 n/a
7 TRCN0000196578 GTTATTGCCTAATCACTCCAA pLKO.1 3715 3UTR 100% 2.640 3.696 N PHKA1 n/a
8 TRCN0000342773 GTTATTGCCTAATCACTCCAA pLKO_005 3715 3UTR 100% 2.640 3.696 N PHKA1 n/a
9 TRCN0000199322 CCAGCCTAGGATGCAACAATA pLKO.1 1594 CDS 100% 13.200 9.240 N PHKA1 n/a
10 TRCN0000199049 CCAGCTGAGCTGAAGCTATTT pLKO.1 1086 CDS 100% 13.200 9.240 N PHKA1 n/a
11 TRCN0000342702 CCAGCTGAGCTGAAGCTATTT pLKO_005 1086 CDS 100% 13.200 9.240 N PHKA1 n/a
12 TRCN0000199346 CTCACCATGCTGGCAGATATT pLKO.1 3366 CDS 100% 13.200 9.240 N PHKA1 n/a
13 TRCN0000052610 CCTGCTCTTCTTAGCCCAAAT pLKO.1 566 CDS 100% 10.800 7.560 N PHKA1P1 n/a
14 TRCN0000199512 GCACTGCCAGTCTATCCTAAA pLKO.1 851 CDS 100% 10.800 7.560 N PHKA1 n/a
15 TRCN0000196619 GTAGAAGAAGTGAACACTTAC pLKO.1 3798 3UTR 100% 10.800 7.560 N PHKA1 n/a
16 TRCN0000025071 GCCATTGTTCTGGACATACTT pLKO.1 1127 CDS 100% 5.625 3.938 N Phka1 n/a
17 TRCN0000322011 GCCATTGTTCTGGACATACTT pLKO_005 1127 CDS 100% 5.625 3.938 N Phka1 n/a
18 TRCN0000006187 CCAGTGACAATCTTATGAGTA pLKO.1 3840 3UTR 100% 4.950 3.465 N PHKA1 n/a
19 TRCN0000052609 CCTTCAAATATAGTCAGAGTA pLKO.1 445 CDS 100% 4.950 3.465 N PHKA1P1 n/a
20 TRCN0000052612 GCAGAGTGTAGTGAAGCTGAT pLKO.1 377 CDS 100% 4.050 2.835 N PHKA1P1 n/a
21 TRCN0000006189 CCACAGTTTATAGACCAGCAA pLKO.1 1707 CDS 100% 2.640 1.848 N PHKA1 n/a
22 TRCN0000052611 CCATGCAAAGTACAACACCAA pLKO.1 479 CDS 100% 2.640 1.848 N PHKA1P1 n/a
23 TRCN0000006191 GCCTGATGAATCTCAGTCCTT pLKO.1 2800 CDS 100% 2.640 1.848 N PHKA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14751 pDONR223 44.5% 93.6% 21.7% None (many diffs) n/a
2 ccsbBroad304_14751 pLX_304 0% 93.6% 21.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468045 TGTTCTGACCCCTTACGGAGCCAC pLX_317 8.8% 93.6% 21.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV