Transcript: Human NM_001320316.1

Homo sapiens MYCBP associated and testis expressed 1 (MAATS1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
MAATS1 (89876)
Length:
4498
CDS:
187..2430

Additional Resources:

NCBI RefSeq record:
NM_001320316.1
NBCI Gene record:
MAATS1 (89876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134935 CCTGATCCATTATCCAAGATA pLKO.1 363 CDS 100% 5.625 7.875 N MAATS1 n/a
2 TRCN0000135140 CAAGGCAGAACCATACACTTT pLKO.1 624 CDS 100% 4.950 6.930 N MAATS1 n/a
3 TRCN0000134634 GTTACTGGAAAGAATCGCTAT pLKO.1 535 CDS 100% 4.050 5.670 N MAATS1 n/a
4 TRCN0000134053 CCAGTAAGGAAGCAACTAAAT pLKO.1 3814 3UTR 100% 13.200 9.240 N MAATS1 n/a
5 TRCN0000135381 GCACAGCGGAAACATATTCTT pLKO.1 2278 CDS 100% 5.625 3.938 N MAATS1 n/a
6 TRCN0000138445 CCAAGGCAGAACCATACACTT pLKO.1 623 CDS 100% 4.950 3.465 N MAATS1 n/a
7 TRCN0000134108 CCATCATAACTGCATACTCAA pLKO.1 4048 3UTR 100% 4.950 3.465 N MAATS1 n/a
8 TRCN0000134107 CCTGATTCAAAGACTGTCAAA pLKO.1 3128 3UTR 100% 4.950 3.465 N MAATS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16053 pDONR223 0% 96% 92.4% None (many diffs) n/a
2 ccsbBroad304_16053 pLX_304 0% 96% 92.4% V5 (many diffs) n/a
3 TRCN0000466472 ATTCCGTGTCGAAGTCTTCGCCTG pLX_317 18.8% 96% 92.4% V5 (many diffs) n/a
4 ccsbBroadEn_09280 pDONR223 100% 96% 92.3% None (many diffs) n/a
5 ccsbBroad304_09280 pLX_304 0% 96% 92.3% V5 (many diffs) n/a
6 TRCN0000474624 CAACTCCTCAGCCCCTTTCTGTTA pLX_317 16% 96% 92.3% V5 (many diffs) n/a
Download CSV