Transcript: Human XM_017012559.1

PREDICTED: Homo sapiens B-Raf proto-oncogene, serine/threonine kinase (BRAF), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRAF (673)
Length:
9441
CDS:
9..2405

Additional Resources:

NCBI RefSeq record:
XM_017012559.1
NBCI Gene record:
BRAF (673)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012559.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006290 CCGCTGTCAAACATGTGGTTA pLKO.1 785 CDS 100% 4.950 6.930 N BRAF n/a
2 TRCN0000196844 GTCATCAGAATGCAAGATAAA pLKO.1 1998 CDS 100% 13.200 10.560 N BRAF n/a
3 TRCN0000196918 GAACATATAGAGGCCCTATTG pLKO.1 183 CDS 100% 10.800 8.640 N BRAF n/a
4 TRCN0000231130 TTACCTGGCTCACTAACTAAC pLKO_005 1344 CDS 100% 10.800 8.640 N BRAF n/a
5 TRCN0000382327 GCATAATCCACCATCAATATA pLKO_005 221 CDS 100% 15.000 10.500 N BRAF n/a
6 TRCN0000231129 TTGGTTGGGACACTGATATTT pLKO_005 631 CDS 100% 15.000 10.500 N BRAF n/a
7 TRCN0000195066 CAGCTTTCAGTCAGATGTATA pLKO.1 2027 CDS 100% 13.200 9.240 N BRAF n/a
8 TRCN0000218636 ATCACCATCTCCATATCATTG pLKO_005 1741 CDS 100% 10.800 7.560 N BRAF n/a
9 TRCN0000231131 CCTACTCTTCATGGGCTATTC pLKO_005 1667 CDS 100% 10.800 7.560 N BRAF n/a
10 TRCN0000195609 CTCAGTAAGGTACGGAGTAAC pLKO.1 2160 CDS 100% 10.800 7.560 N BRAF n/a
11 TRCN0000380549 CTGATGATGAGAGGTCTAATC pLKO_005 561 CDS 100% 10.800 7.560 N BRAF n/a
12 TRCN0000006289 GCAGATGAAGATCATCGAAAT pLKO.1 1053 CDS 100% 10.800 7.560 N BRAF n/a
13 TRCN0000006292 CAGCAGTTACAAGCCTTCAAA pLKO.1 1605 CDS 100% 5.625 3.938 N BRAF n/a
14 TRCN0000006293 CTATGAAGAATACACCAGCAA pLKO.1 251 CDS 100% 2.640 1.848 N BRAF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012559.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00174 pDONR223 100% 89.3% 87.7% None (many diffs) n/a
2 ccsbBroad304_00174 pLX_304 0% 89.3% 87.7% V5 (many diffs) n/a
3 TRCN0000478042 TCTGAATTAGGGTTGATCCCCCGC pLX_317 17.9% 89.3% 87.7% V5 (many diffs) n/a
4 TRCN0000489575 CGTTCGGAATTCTGTGTTGTACCC pLX_317 15.7% 89.3% 87.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489494 GTTAACTACCATGGAAACCTGCTA pLX_317 14.9% 89.3% 87.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_16175 pDONR223 0% 89.2% 87.6% None (many diffs) n/a
7 ccsbBroad304_16175 pLX_304 0% 89.2% 87.6% V5 (many diffs) n/a
8 TRCN0000491583 CCCTCTGATACCGCCGCCACCAGA pLX_317 17.6% 89.2% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_14553 pDONR223 65.1% 82.9% 25.3% None (many diffs) n/a
10 ccsbBroad304_14553 pLX_304 0% 82.9% 25.3% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000480310 GCCCGGTAACTCGCTTTGGCCAAA pLX_317 17.4% 82.9% 25.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV