Transcript: Human XM_011526361.2

PREDICTED: Homo sapiens leukocyte immunoglobulin like receptor B5 (LILRB5), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LILRB5 (10990)
Length:
2441
CDS:
100..2061

Additional Resources:

NCBI RefSeq record:
XM_011526361.2
NBCI Gene record:
LILRB5 (10990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056871 GACGGACTTCTCACGTTTGTT pLKO.1 541 CDS 100% 5.625 7.875 N LILRB5 n/a
2 TRCN0000056872 TCTATGCAGAACCCACTCTTT pLKO.1 458 CDS 100% 4.950 6.930 N LILRB5 n/a
3 TRCN0000056870 GCATCAGATAGACACTTTCTT pLKO.1 1140 CDS 100% 5.625 4.500 N LILRB5 n/a
4 TRCN0000432030 ACCGATGCTACAGCGCAATCA pLKO_005 1277 CDS 100% 4.950 3.960 N LILRB5 n/a
5 TRCN0000056869 GCTGACATCCAGGAGGAAATT pLKO.1 1600 CDS 100% 13.200 9.240 N LILRB5 n/a
6 TRCN0000056868 GCTGTGTCTAAAGTCAAAGTA pLKO.1 1191 CDS 100% 5.625 3.938 N LILRB5 n/a
7 TRCN0000417376 CCACACCTGGTCTGGGAAGAT pLKO_005 1397 CDS 100% 1.650 0.825 Y LILRB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14983 pDONR223 54.7% 85.6% 85.5% None (many diffs) n/a
2 ccsbBroad304_14983 pLX_304 0% 85.6% 85.5% V5 (many diffs) n/a
3 TRCN0000479724 AATACAGTCTCGATGTATTCGCGG pLX_317 36% 48.1% 47.9% V5 938A>C;944_953delTGATCGCAGG;956_1959del n/a
4 ccsbBroadEn_11582 pDONR223 100% 81.3% 71.2% None (many diffs) n/a
5 ccsbBroad304_11582 pLX_304 0% 81.3% 71.2% V5 (many diffs) n/a
6 TRCN0000476797 GACTTACTCCCCGGATCTCGTAGG pLX_317 13.1% 81.3% 71.2% V5 (many diffs) n/a
7 ccsbBroadEn_07723 pDONR223 100% 53% 44.8% None (many diffs) n/a
8 ccsbBroad304_07723 pLX_304 0% 53% 44.8% V5 (many diffs) n/a
9 TRCN0000478308 ATCGACTTCGATGCCTGGACTCCC pLX_317 25% 53% 44.8% V5 (many diffs) n/a
Download CSV