Transcript: Human XM_017010873.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 5 (MAP3K5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K5 (4217)
Length:
5519
CDS:
356..4807

Additional Resources:

NCBI RefSeq record:
XM_017010873.1
NBCI Gene record:
MAP3K5 (4217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431592 GCACTCCTTCATCGAGCTATT pLKO_005 4484 CDS 100% 10.800 15.120 N MAP3K5 n/a
2 TRCN0000416310 GCAAATACTGGAAGGATTAAA pLKO_005 3037 CDS 100% 15.000 10.500 N MAP3K5 n/a
3 TRCN0000219666 ATTCGGCAGCGAGTAGATAAT pLKO.1 1577 CDS 100% 13.200 9.240 N MAP3K5 n/a
4 TRCN0000219665 CAGTACTTCCGGGAATCTATA pLKO.1 1490 CDS 100% 13.200 9.240 N MAP3K5 n/a
5 TRCN0000419788 GCTCTTTCAGCTGGATCAAAT pLKO_005 3539 CDS 100% 13.200 9.240 N MAP3K5 n/a
6 TRCN0000427691 TAAAGTTCTTCGGAATCATAA pLKO_005 4099 CDS 100% 13.200 9.240 N MAP3K5 n/a
7 TRCN0000195438 CCTTGCATCTGAGAGTGATAC pLKO.1 4219 CDS 100% 10.800 7.560 N MAP3K5 n/a
8 TRCN0000419570 GCTATTGCACTTCAGCCAAAT pLKO_005 5107 3UTR 100% 10.800 7.560 N MAP3K5 n/a
9 TRCN0000195146 CCTTCTTATTTGTCTATCAAC pLKO.1 2396 CDS 100% 4.950 3.465 N MAP3K5 n/a
10 TRCN0000000992 CGGGACATAAAGGGTGACAAT pLKO.1 3086 CDS 100% 4.950 3.465 N MAP3K5 n/a
11 TRCN0000000995 CTGCGGAGAAAGAGATGTCAA pLKO.1 3694 CDS 100% 4.950 3.465 N MAP3K5 n/a
12 TRCN0000000991 TGTTTAGGCTTCTGTGTGTTT pLKO.1 5205 3UTR 100% 4.950 3.465 N MAP3K5 n/a
13 TRCN0000000994 GAAGACACTATAAGCCGGTTT pLKO.1 4652 CDS 100% 4.050 2.835 N MAP3K5 n/a
14 TRCN0000000993 GCTTACCTCTTGTGGATCGTT pLKO.1 1431 CDS 100% 3.000 2.100 N MAP3K5 n/a
15 TRCN0000194958 CCAGTATTTGTTTACTCATGT pLKO.1 4916 3UTR 100% 4.950 2.970 N MAP3K5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488094 ACGAATCAGCTTAATCGTCTTCTC pLX_317 7.5% 92.6% 92.6% V5 (not translated due to prior stop codon) 1_327del;1884A>G n/a
2 TRCN0000488584 TTACTGGCCTAATCGATGTGTGTT pLX_317 7.8% 92.5% 92.5% V5 (many diffs) n/a
3 ccsbBroadEn_14695 pDONR223 10.9% 86.8% 2.8% None (many diffs) n/a
4 ccsbBroad304_14695 pLX_304 10.4% 86.8% 2.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000467146 TCTTGTTAAGTTATAACTTGTTTC pLX_317 8.2% 86.8% 2.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV