Transcript: Mouse XM_017316811.1

PREDICTED: Mus musculus RNA binding protein, fox-1 homolog (C. elegans) 2 (Rbfox2), transcript variant X18, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbfox2 (93686)
Length:
3801
CDS:
505..1782

Additional Resources:

NCBI RefSeq record:
XM_017316811.1
NBCI Gene record:
Rbfox2 (93686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316811.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074544 CGGGTTCGTAACTTTCGAGAA pLKO.1 978 CDS 100% 4.050 5.670 N RBFOX2 n/a
2 TRCN0000311693 CGGGTTCGTAACTTTCGAGAA pLKO_005 978 CDS 100% 4.050 5.670 N RBFOX2 n/a
3 TRCN0000102343 CGACTACATGTCTCTAATATT pLKO.1 856 CDS 100% 15.000 10.500 N Rbfox2 n/a
4 TRCN0000102342 CCTCTAATCAGTCTCCCTTTA pLKO.1 1264 CDS 100% 10.800 7.560 N Rbfox2 n/a
5 TRCN0000102344 GCTGTGTATGGTCCTGAGTTA pLKO.1 1153 CDS 100% 4.950 3.465 N Rbfox2 n/a
6 TRCN0000102341 CCCTCTAATCAGTCTCCCTTT pLKO.1 1263 CDS 100% 4.050 2.835 N Rbfox2 n/a
7 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3411 3UTR 100% 4.950 2.475 Y CFLAR n/a
8 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3411 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316811.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02790 pDONR223 100% 75.9% 69.7% None (many diffs) n/a
2 ccsbBroad304_02790 pLX_304 0% 75.9% 69.7% V5 (many diffs) n/a
3 ccsbBroadEn_11745 pDONR223 100% 71.2% 64.5% None (many diffs) n/a
4 ccsbBroad304_11745 pLX_304 0% 71.2% 64.5% V5 (many diffs) n/a
5 TRCN0000478244 AAGGTTCGACCCGCACGGCTGATA pLX_317 24.7% 71.2% 64.5% V5 (many diffs) n/a
Download CSV