Transcript: Mouse XM_017319039.1

PREDICTED: Mus musculus myosin IIIB (Myo3b), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myo3b (329421)
Length:
5237
CDS:
93..4010

Additional Resources:

NCBI RefSeq record:
XM_017319039.1
NBCI Gene record:
Myo3b (329421)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319039.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110530 GCCGTCATACTCTATACAGTT pLKO.1 4918 3UTR 100% 4.950 6.930 N Myo3b n/a
2 TRCN0000110531 CCTCACTTTATTCGTTGCATT pLKO.1 2907 CDS 100% 4.950 3.960 N Myo3b n/a
3 TRCN0000025307 CGAAGCTGTGATTTCCTACAT pLKO.1 443 CDS 100% 4.950 3.960 N Myo3b n/a
4 TRCN0000110532 CCATGTACTATAACCAGTTAA pLKO.1 3802 CDS 100% 13.200 9.240 N Myo3b n/a
5 TRCN0000194885 CCATGTACTATAACCAGTTAA pLKO.1 3802 CDS 100% 13.200 9.240 N MYO3B n/a
6 TRCN0000110534 GCTATGATGCTCGGAGGAAAT pLKO.1 3355 CDS 100% 10.800 7.560 N Myo3b n/a
7 TRCN0000025308 CCATCCCAACGTTGTAAAGTT pLKO.1 296 CDS 100% 5.625 3.938 N Myo3b n/a
8 TRCN0000025305 CAGCAGTATGACTCGTCCTAT pLKO.1 675 CDS 100% 4.950 3.465 N Myo3b n/a
9 TRCN0000025306 CTGCGGAGAAACACATCAGTT pLKO.1 612 CDS 100% 4.950 3.465 N Myo3b n/a
10 TRCN0000110533 GCTGTGTTGCTATCTTGGAAA pLKO.1 3124 CDS 100% 4.950 3.465 N Myo3b n/a
11 TRCN0000002402 GCAGCTATTTCCTCTCAACAT pLKO.1 1908 CDS 100% 4.950 3.960 N MYO3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319039.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15253 pDONR223 36.9% 81.8% 75.4% None (many diffs) n/a
2 ccsbBroad304_15253 pLX_304 0% 81.8% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469340 CCCGGACATTGGAGAATAGCCTAG pLX_317 8.6% 81.8% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV