Transcript: Mouse XR_001780060.1

PREDICTED: Mus musculus ribosomal protein S6 kinase, polypeptide 1 (Rps6kb1), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rps6kb1 (72508)
Length:
5474
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780060.1
NBCI Gene record:
Rps6kb1 (72508)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022904 GCATGGAACATTGTGAGAAAT pLKO.1 285 3UTR 100% 13.200 10.560 N Rps6kb1 n/a
2 TRCN0000297869 GCATGGAACATTGTGAGAAAT pLKO_005 285 3UTR 100% 13.200 10.560 N Rps6kb1 n/a
3 TRCN0000350402 TTTGCCATGAAGGTGCTTAAA pLKO_005 449 3UTR 100% 13.200 9.240 N RPS6KB1 n/a
4 TRCN0000003161 TATTTGCCATGAAGGTGCTTA pLKO.1 447 3UTR 100% 4.950 3.465 N RPS6KB1 n/a
5 TRCN0000022905 CCCTTTCATTGTGGACCTGAT pLKO.1 547 3UTR 100% 4.050 2.835 N Rps6kb1 n/a
6 TRCN0000280514 CCCTTTCATTGTGGACCTGAT pLKO_005 547 3UTR 100% 4.050 2.835 N Rps6kb1 n/a
7 TRCN0000022907 GCAGTTAGAAAGAGAGGGAAT pLKO.1 637 3UTR 100% 4.050 2.430 N Rps6kb1 n/a
8 TRCN0000280573 GCAGTTAGAAAGAGAGGGAAT pLKO_005 637 3UTR 100% 4.050 2.430 N Rps6kb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489919 CGAACCTTCGACTGCACGAATTCC pLX_317 24.5% 27.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_11109 pDONR223 100% 23.4% None (many diffs) n/a
3 ccsbBroad304_11109 pLX_304 0% 23.4% V5 (many diffs) n/a
4 TRCN0000479002 ATGGCACAGCTAGAATGACTTCCC pLX_317 27.7% 23.4% V5 (many diffs) n/a
5 ccsbBroadEn_14833 pDONR223 0% 23.4% None (many diffs) n/a
6 ccsbBroad304_14833 pLX_304 49.9% 23.4% V5 (many diffs) n/a
7 TRCN0000481178 ACCACACGATGAGTAGACCGGCCA pLX_317 32.8% 23.4% V5 (many diffs) n/a
Download CSV