Transcript: Human XM_017005193.2

PREDICTED: Homo sapiens CASP8 and FADD like apoptosis regulator (CFLAR), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFLAR (8837)
Length:
13257
CDS:
2474..3862

Additional Resources:

NCBI RefSeq record:
XM_017005193.2
NBCI Gene record:
CFLAR (8837)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364098 CCAGATCAACTGGATTTATTA pLKO_005 2909 CDS 100% 15.000 21.000 N CFLAR n/a
2 TRCN0000320671 ATCTCAGTATGCATGGTATAT pLKO_005 3321 CDS 100% 13.200 18.480 N CFLAR n/a
3 TRCN0000320672 GTAAACGCTGTCCCTAGTAAA pLKO_005 4867 3UTR 100% 13.200 18.480 N CFLAR n/a
4 TRCN0000364099 CTCTACAGAGTGAGGCGATTT pLKO_005 2648 CDS 100% 10.800 15.120 N CFLAR n/a
5 TRCN0000320670 TAGATGTGGTTCCACCTAATG pLKO_005 2562 CDS 100% 10.800 15.120 N CFLAR n/a
6 TRCN0000007229 CCTCACCTTGTTTCGGACTAT pLKO.1 2732 CDS 100% 4.950 3.960 N CFLAR n/a
7 TRCN0000320749 TTGGTGAGGATTTGGATAAAT pLKO_005 2772 CDS 100% 15.000 10.500 N CFLAR n/a
8 TRCN0000378209 ACATGGGCCGAGGCAAGATAA pLKO_005 2829 CDS 100% 13.200 9.240 N CFLAR n/a
9 TRCN0000350280 CTCACCTTGTTTCGGACTATA pLKO_005 2733 CDS 100% 13.200 9.240 N CFLAR n/a
10 TRCN0000007230 GCTCCATAATGGGAGAAGTAA pLKO.1 3079 CDS 100% 5.625 3.938 N CFLAR n/a
11 TRCN0000007231 GCATCACATCAGGAGGATGTT pLKO.1 3472 CDS 100% 0.495 0.347 N CFLAR n/a
12 TRCN0000007232 CACTCTGAGAAAGAAACTTAT pLKO.1 4719 3UTR 100% 13.200 7.920 N CFLAR n/a
13 TRCN0000256745 CAGCCTGGCCAACATGGTAAA pLKO_005 4851 3UTR 100% 10.800 5.400 Y SMIM11A n/a
14 TRCN0000134155 CCTTCCTTACACCTTATACAA pLKO.1 10213 3UTR 100% 5.625 2.813 Y FSIP2 n/a
15 TRCN0000165057 GAGTGGACACAGCACATGTTT pLKO.1 6639 3UTR 100% 5.625 2.813 Y LOC389286 n/a
16 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4785 3UTR 100% 4.950 2.475 Y CFLAR n/a
17 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4785 3UTR 100% 4.950 2.475 Y C19orf31 n/a
18 TRCN0000021409 GCTGCCTTCAAGCATCTGTTT pLKO.1 6577 3UTR 100% 4.950 2.475 Y NEK5 n/a
19 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 8818 3UTR 100% 4.050 2.025 Y INTS7 n/a
20 TRCN0000161379 GCATCTGTTTAACAAAGCACA pLKO.1 6588 3UTR 100% 2.640 1.320 Y LOC389286 n/a
21 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1447 5UTR 100% 5.625 2.813 Y KLHL30 n/a
22 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4783 3UTR 100% 4.950 2.475 Y ERN2 n/a
23 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4783 3UTR 100% 4.950 2.475 Y P3H4 n/a
24 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4783 3UTR 100% 4.950 2.475 Y P3H4 n/a
25 TRCN0000129739 CTCTCAAGTAGCTGAGATTAT pLKO.1 1311 5UTR 100% 1.320 0.660 Y PACRG n/a
26 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1447 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02030 pDONR223 100% 93.7% 87.9% None (many diffs) n/a
2 ccsbBroad304_02030 pLX_304 0% 93.7% 87.9% V5 (many diffs) n/a
3 TRCN0000466010 GCCCTAAGGACAATAGACCAGTAT pLX_317 22.8% 93.7% 87.9% V5 (many diffs) n/a
Download CSV