Transcript: Human NM_004993.6

Homo sapiens ataxin 3 (ATXN3), transcript variant reference, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
ATXN3 (4287)
Length:
6884
CDS:
31..1116

Additional Resources:

NCBI RefSeq record:
NM_004993.6
NBCI Gene record:
ATXN3 (4287)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004993.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430819 CTCAGGATCGATCCTATAAAT pLKO_005 334 CDS 100% 15.000 21.000 N ATXN3 n/a
2 TRCN0000430436 ATTACAACAGGAAGGTTATTC pLKO_005 492 CDS 100% 13.200 18.480 N ATXN3 n/a
3 TRCN0000007407 GCAGGGCTATTCAGCTAAGTA pLKO.1 779 CDS 100% 5.625 7.875 N ATXN3 n/a
4 TRCN0000007408 CGCCAAGAAATTGACATGGAA pLKO.1 739 CDS 100% 3.000 4.200 N ATXN3 n/a
5 TRCN0000435828 ACAGCAGCCTTCTGGAAATAT pLKO_005 216 CDS 100% 15.000 10.500 N ATXN3 n/a
6 TRCN0000007405 CGTCGGTTGTAGGACTAAATA pLKO.1 1266 3UTR 100% 15.000 10.500 N ATXN3 n/a
7 TRCN0000421304 ACACAGACATCAGGTACAAAT pLKO_005 835 CDS 100% 13.200 9.240 N ATXN3 n/a
8 TRCN0000412482 GCAGCTGTGACCATGTCTTTA pLKO_005 1054 CDS 100% 13.200 9.240 N ATXN3 n/a
9 TRCN0000007409 GTGCTCAACATTGCCTGAATA pLKO.1 71 CDS 100% 13.200 9.240 N ATXN3 n/a
10 TRCN0000424204 AGAGACGAGAAGCCTACTTTG pLKO_005 878 CDS 100% 10.800 7.560 N ATXN3 n/a
11 TRCN0000433180 ATGTCTAAAGTTAGGGCATTT pLKO_005 1389 3UTR 100% 10.800 7.560 N ATXN3 n/a
12 TRCN0000432161 CCAACTCCTGCAGATGATTAG pLKO_005 555 CDS 100% 10.800 7.560 N ATXN3 n/a
13 TRCN0000007406 CGAGTGTTAGAAGCAAATGAT pLKO.1 661 CDS 100% 5.625 3.938 N ATXN3 n/a
14 TRCN0000423485 TTGACGGGTCCAGAATTAATA pLKO_005 439 CDS 100% 15.000 9.000 N ATXN3 n/a
15 TRCN0000422964 TTATAAGGAACACTGGTTTAC pLKO_005 375 CDS 100% 10.800 6.480 N ATXN3 n/a
16 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 5259 3UTR 100% 4.950 2.475 Y GJD4 n/a
17 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 5259 3UTR 100% 4.950 2.475 Y C9orf85 n/a
18 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 3417 3UTR 100% 1.080 0.540 Y GPR83 n/a
19 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 3417 3UTR 100% 1.080 0.540 Y MYORG n/a
20 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4589 3UTR 100% 10.800 5.400 Y SMIM11A n/a
21 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5855 3UTR 100% 5.625 2.813 Y KLHL30 n/a
22 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5855 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004993.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13896 pDONR223 100% 97.2% 95.6% None (many diffs) n/a
2 ccsbBroad304_13896 pLX_304 0% 97.2% 95.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000470627 AGGGTCAACTTGCCCGAATTCAAC pLX_317 41.5% 97.2% 95.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV