Transcript: Human NM_001260.3

Homo sapiens cyclin dependent kinase 8 (CDK8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-14
Taxon:
Homo sapiens (human)
Gene:
CDK8 (1024)
Length:
3065
CDS:
514..1908

Additional Resources:

NCBI RefSeq record:
NM_001260.3
NBCI Gene record:
CDK8 (1024)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001260.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199980 GTCCATGCACTGTTGCGAATG pLKO.1 1925 3UTR 100% 6.000 8.400 N CDK8 n/a
2 TRCN0000000493 CACTTCCTACATCAGACGTTT pLKO.1 1529 CDS 100% 4.950 6.930 N CDK8 n/a
3 TRCN0000195463 CGAGAGCTTAAGCATCCAAAC pLKO.1 724 CDS 100% 6.000 4.800 N CDK8 n/a
4 TRCN0000000490 GCAGGGCAATAACCACACTAA pLKO.1 1641 CDS 100% 4.950 3.960 N CDK8 n/a
5 TRCN0000320651 GCAGGGCAATAACCACACTAA pLKO_005 1641 CDS 100% 4.950 3.960 N CDK8 n/a
6 TRCN0000023106 CCCGATTATTTAATTCACCTT pLKO.1 1043 CDS 100% 2.640 2.112 N Cdk8 n/a
7 TRCN0000382350 ATGGTGAAGTCACTATTATAT pLKO_005 892 CDS 100% 15.000 10.500 N CDK8 n/a
8 TRCN0000322391 CATGGGCTTTGCCCGATTATT pLKO_005 1032 CDS 100% 15.000 10.500 N Cdk8 n/a
9 TRCN0000322410 CTAACGTCAGAACCAATATTT pLKO_005 1195 CDS 100% 15.000 10.500 N Cdk8 n/a
10 TRCN0000350308 CTAACGTCAGAACCAATATTT pLKO_005 1195 CDS 100% 15.000 10.500 N CDK8 n/a
11 TRCN0000196569 GAATGGTGAAGTCACTATTAT pLKO.1 890 CDS 100% 15.000 10.500 N CDK8 n/a
12 TRCN0000350344 GCTTACCATGGACCCAATAAA pLKO_005 1458 CDS 100% 15.000 10.500 N CDK8 n/a
13 TRCN0000195594 CACTACCTCAGGTGGACTTAT pLKO.1 1743 CDS 100% 13.200 9.240 N CDK8 n/a
14 TRCN0000322329 TTTGGGCTATAGGGTGTATAT pLKO_005 1163 CDS 100% 13.200 9.240 N Cdk8 n/a
15 TRCN0000196702 GCTATTGATATTTGGGCTATA pLKO.1 1153 CDS 100% 10.800 7.560 N CDK8 n/a
16 TRCN0000194708 CATGAGAATGTACTGTACAAC pLKO.1 1991 3UTR 100% 4.950 3.465 N CDK8 n/a
17 TRCN0000000491 CCTCTGGCATATAATCAAGTT pLKO.1 822 CDS 100% 4.950 3.465 N CDK8 n/a
18 TRCN0000023264 GCCTTATCAAGTATATGGAAA pLKO.1 1388 CDS 100% 4.950 3.465 N LOC219029 n/a
19 TRCN0000000492 CAAGGCATTATACCAAAGCTA pLKO.1 1136 CDS 100% 3.000 2.100 N CDK8 n/a
20 TRCN0000000489 ATGTCCAGTAGCCAAGTTCCA pLKO.1 2024 3UTR 100% 2.640 1.848 N CDK8 n/a
21 TRCN0000320652 ATGTCCAGTAGCCAAGTTCCA pLKO_005 2024 3UTR 100% 2.640 1.848 N CDK8 n/a
22 TRCN0000199779 GAACCTGGTATGGGCCATGAG pLKO.1 1976 3UTR 100% 1.350 0.945 N CDK8 n/a
23 TRCN0000362345 TATATTTGCAGAACTACTAAC pLKO_005 1179 CDS 100% 10.800 6.480 N Cdk8 n/a
24 TRCN0000023108 GCAGATAAAGATTGGGAAGAT pLKO.1 1300 CDS 100% 4.950 2.970 N Cdk8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001260.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00281 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00281 pLX_304 43.6% 100% 100% V5 n/a
3 TRCN0000491308 AAAACCCTGTGTGATATTATTCCA pLX_317 24.9% 100% 100% V5 (not translated due to prior stop codon) n/a
4 ccsbBroadEn_14578 pDONR223 0% 99.7% 99.7% None 1111_1113delAAG n/a
5 TRCN0000470983 CCGCTCGAGGCCCAGAGGACATAG pLX_317 29.7% 99.7% 99.7% V5 1111_1113delAAG n/a
6 ccsbBroad304_14578 pLX_304 50.6% 85.4% 47.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV