Transcript: Human NM_001368301.1

Homo sapiens GTF2I repeat domain containing 2B (GTF2IRD2B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-04-15
Taxon:
Homo sapiens (human)
Gene:
GTF2IRD2B (389524)
Length:
617
CDS:
216..542

Additional Resources:

NCBI RefSeq record:
NM_001368301.1
NBCI Gene record:
GTF2IRD2B (389524)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001368301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157406 GCCCTCGAATCCATGTGTAAA pLKO.1 300 CDS 100% 13.200 6.600 Y GTF2IRD2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12785 pDONR223 100% 38.3% 32.1% None (many diffs) n/a
2 ccsbBroad304_12785 pLX_304 0% 38.3% 32.1% V5 (many diffs) n/a
3 TRCN0000469667 CGATCACCGATGTAAGTTTATTTC pLX_317 48.6% 38.3% 32.1% V5 (many diffs) n/a
4 ccsbBroadEn_12786 pDONR223 100% 19.8% 16.8% None (many diffs) n/a
5 ccsbBroad304_12786 pLX_304 0% 19.8% 16.8% V5 (many diffs) n/a
6 TRCN0000465352 GATGGCAATATAAGTGATGTTCTC pLX_317 21.4% 19.8% 16.8% V5 (many diffs) n/a
7 ccsbBroadEn_14494 pDONR223 100% 10.4% 8.8% None (many diffs) n/a
8 ccsbBroad304_14494 pLX_304 0% 10.4% 8.8% V5 (not translated due to frame shift) (many diffs) n/a
9 TRCN0000475879 CAAGAACGGTTTTTTCTGCCATGC pLX_317 12.2% 10.4% 8.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV