Transcript: Human XM_017009846.2

PREDICTED: Homo sapiens cyclin J like (CCNJL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCNJL (79616)
Length:
3404
CDS:
65..1678

Additional Resources:

NCBI RefSeq record:
XM_017009846.2
NBCI Gene record:
CCNJL (79616)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009846.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425714 CCACTTCATGGATCGCTACAA pLKO_005 574 CDS 100% 4.950 6.930 N CCNJL n/a
2 TRCN0000158409 CCTCAAGGAGTATGCCCATTA pLKO.1 1054 CDS 100% 10.800 7.560 N CCNJL n/a
3 TRCN0000156748 GTCACCCTGCAAGATCACATA pLKO.1 1085 CDS 100% 4.950 3.465 N CCNJL n/a
4 TRCN0000158129 CTGCATCCCTTAGCATGCATA pLKO.1 1557 CDS 100% 0.495 0.347 N CCNJL n/a
5 TRCN0000157639 CCTTAGCATGCATATGGCCAT pLKO.1 1564 CDS 100% 0.000 0.000 N CCNJL n/a
6 TRCN0000447152 GAGCACCTCAGCACGTGTATT pLKO_005 1223 CDS 100% 13.200 7.920 N CCNJL n/a
7 TRCN0000157225 GCAAACGGAGTTTCGCTCTTA pLKO.1 647 CDS 100% 4.950 2.970 N CCNJL n/a
8 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 687 CDS 100% 4.950 2.475 Y CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009846.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12574 pDONR223 100% 67.9% 67.9% None 1_516del n/a
2 ccsbBroad304_12574 pLX_304 0% 67.9% 67.9% V5 1_516del n/a
3 TRCN0000470812 GGCTGATGGTCTAGTTTCTTTACA pLX_317 35.9% 67.9% 67.9% V5 1_516del n/a
4 ccsbBroadEn_12573 pDONR223 100% 22.5% 22.5% None 1_1248del n/a
5 ccsbBroad304_12573 pLX_304 0% 22.5% 22.5% V5 1_1248del n/a
6 TRCN0000473352 ATGACTCTTGTCATTTAACGATTG pLX_317 100% 22.5% 22.5% V5 1_1248del n/a
Download CSV