Transcript: Human NM_000767.5

Homo sapiens cytochrome P450 family 2 subfamily B member 6 (CYP2B6), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CYP2B6 (1555)
Length:
3071
CDS:
25..1500

Additional Resources:

NCBI RefSeq record:
NM_000767.5
NBCI Gene record:
CYP2B6 (1555)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000767.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064045 GTGTGATCTTTGCCAATGGAA pLKO.1 359 CDS 100% 3.000 2.100 N CYP2B6 n/a
2 TRCN0000064046 CCTGCAGGAAATCAATGCTTA pLKO.1 735 CDS 100% 4.950 2.970 N CYP2B6 n/a
3 TRCN0000064043 CGATTCCACTACCAAGATCAA pLKO.1 583 CDS 100% 4.950 2.970 N CYP2B6 n/a
4 TRCN0000064044 GCCTTCAATCCTGACCACTTT pLKO.1 1243 CDS 100% 4.950 2.475 Y CYP2B6 n/a
5 TRCN0000064047 GCCTACTCAAATCCTTTCTGA pLKO.1 173 CDS 100% 3.000 1.500 Y CYP2B6 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1973 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000173917 GCCAACATCATCTGCTCCATT pLKO.1 550 CDS 100% 4.950 2.475 Y Cyp2b9 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1973 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000767.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06074 pDONR223 100% 99.7% 99.5% None 516G>T;714G>A;785A>G n/a
2 ccsbBroad304_06074 pLX_304 0% 99.7% 99.5% V5 516G>T;714G>A;785A>G n/a
3 TRCN0000477273 TACCCCATGCTGAATCCCTATTGT pLX_317 20.7% 99.7% 99.5% V5 516G>T;714G>A;785A>G n/a
4 ccsbBroadEn_10223 pDONR223 100% 73.3% 70% None (many diffs) n/a
5 ccsbBroad304_10223 pLX_304 0% 73.3% 70% V5 (many diffs) n/a
6 TRCN0000466850 AGGCGCTCCGGATATCTATCGGCC pLX_317 37.3% 73.3% 70% V5 (many diffs) n/a
Download CSV