Transcript: Human NM_000777.5

Homo sapiens cytochrome P450 family 3 subfamily A member 5 (CYP3A5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
CYP3A5 (1577)
Length:
1720
CDS:
101..1609

Additional Resources:

NCBI RefSeq record:
NM_000777.5
NBCI Gene record:
CYP3A5 (1577)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000777.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064236 CCCTTGAAATTAGACACGCAA pLKO.1 1517 CDS 100% 2.640 3.696 N CYP3A5 n/a
2 TRCN0000064237 CGTCAGGGTCTCTGGAAATTT pLKO.1 260 CDS 100% 15.000 10.500 N CYP3A5 n/a
3 TRCN0000064234 GCAGTGTTCTTTCCTTCACTT pLKO.1 1032 CDS 100% 4.950 3.465 N CYP3A5 n/a
4 TRCN0000064233 GCATTAAATGTCTCTCTGTTT pLKO.1 803 CDS 100% 4.950 3.465 N CYP3A5 n/a
5 TRCN0000064235 CCCATTGTTCTAAAGGTGGAT pLKO.1 1559 CDS 100% 2.640 1.584 N CYP3A5 n/a
6 TRCN0000064020 CCTTACATATACACACCCTTT pLKO.1 1382 CDS 100% 4.050 2.025 Y CYP3A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000777.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00412 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00412 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468230 ATCAACTGGCCTGCGCCACCCCTT pLX_317 31.3% 100% 100% V5 n/a
4 ccsbBroadEn_00411 pDONR223 100% 89.2% 84% None (many diffs) n/a
5 ccsbBroad304_00411 pLX_304 0% 89.2% 84% V5 (many diffs) n/a
6 TRCN0000477588 ATCTATTATTTATGACGGCGACCT pLX_317 35.4% 89.2% 84% V5 (many diffs) n/a
7 ccsbBroadEn_06073 pDONR223 100% 88.4% 81.7% None (many diffs) n/a
8 ccsbBroad304_06073 pLX_304 0% 88.4% 81.7% V5 (many diffs) n/a
9 TRCN0000470575 CTAAAATCTCGCTGGTGGCATAGC pLX_317 30.2% 88.4% 81.7% V5 (many diffs) n/a
Download CSV