Transcript: Human XM_011521638.3

PREDICTED: Homo sapiens neurotrophic receptor tyrosine kinase 3 (NTRK3), transcript variant X24, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NTRK3 (4916)
Length:
2341
CDS:
639..2048

Additional Resources:

NCBI RefSeq record:
XM_011521638.3
NBCI Gene record:
NTRK3 (4916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521638.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379993 ATATGGTCGACGGTCCAAATT pLKO_005 2003 CDS 100% 13.200 18.480 N NTRK3 n/a
2 TRCN0000002313 CACGGACATCTCAAGGAATAT pLKO.1 857 CDS 100% 13.200 18.480 N NTRK3 n/a
3 TRCN0000338261 CACGGACATCTCAAGGAATAT pLKO_005 857 CDS 100% 13.200 18.480 N NTRK3 n/a
4 TRCN0000381538 ACGCTGAGTCTTCGGGAATTG pLKO_005 1083 CDS 100% 10.800 8.640 N NTRK3 n/a
5 TRCN0000023514 GCAGCAAGACTGAGATCAATT pLKO.1 751 CDS 100% 13.200 9.240 N Ntrk3 n/a
6 TRCN0000379636 GCAGCAAGACTGAGATCAATT pLKO_005 751 CDS 100% 13.200 9.240 N NTRK3 n/a
7 TRCN0000368951 AGCAATGGGAACGCCAGTATC pLKO_005 831 CDS 100% 10.800 7.560 N NTRK3 n/a
8 TRCN0000361391 AGTGTAGTTTCTGGCGGATTT pLKO_005 664 CDS 100% 10.800 7.560 N Ntrk3 n/a
9 TRCN0000195281 CGGATAACTTTATCTTGTTTG pLKO.1 1849 CDS 100% 10.800 7.560 N NTRK3 n/a
10 TRCN0000002309 CACTACAACAATGGCAACTAT pLKO.1 1746 CDS 100% 5.625 3.938 N NTRK3 n/a
11 TRCN0000195282 CCAATGTTCATGCCATCAACT pLKO.1 1420 CDS 100% 4.950 3.465 N NTRK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521638.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06660 pDONR223 100% 76.4% 76.1% None (many diffs) n/a
2 ccsbBroad304_06660 pLX_304 0% 76.4% 76.1% V5 (many diffs) n/a
3 TRCN0000466614 AAAGTCTCTCTGTCTGGGCCCTCG pLX_317 19.7% 76.4% 76.1% V5 (many diffs) n/a
4 TRCN0000489478 CACGGAAAAAGCCGCCAGTGATGG pLX_317 16.1% 56.7% 56.4% V5 (many diffs) n/a
5 TRCN0000488840 TCGATGGTACGGTTACAATCTGAG pLX_317 13.2% 56.7% 56.4% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000491535 CCGAAACTCTCCGAGAGGCGTCAT pLX_317 12.8% 56.6% 56.4% V5 (many diffs) n/a
7 ccsbBroadEn_14722 pDONR223 0% 55.7% 55.5% None (many diffs) n/a
8 ccsbBroad304_14722 pLX_304 0% 55.7% 55.5% V5 (many diffs) n/a
9 TRCN0000472061 TCCTAGCAGCACTATGGTACACGG pLX_317 17.1% 55.7% 55.5% V5 (many diffs) n/a
Download CSV