Transcript: Human NM_001282805.2

Homo sapiens membrane associated ring-CH-type finger 7 (MARCHF7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
MARCHF7 (64844)
Length:
6043
CDS:
244..2358

Additional Resources:

NCBI RefSeq record:
NM_001282805.2
NBCI Gene record:
MARCHF7 (64844)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282805.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365353 TCCAGCACTTGGGAGTAATTT pLKO_005 1710 CDS 100% 15.000 21.000 N MARCHF7 n/a
2 TRCN0000073070 GCTTCTGAAGTTCCCGATAAT pLKO.1 1240 CDS 100% 13.200 18.480 N MARCHF7 n/a
3 TRCN0000073068 CGGAGACCATAACAGGACATT pLKO.1 2325 CDS 100% 4.950 6.930 N MARCHF7 n/a
4 TRCN0000073072 CGTGTCCGATTTATTAACCTT pLKO.1 2242 CDS 100% 3.000 4.200 N MARCHF7 n/a
5 TRCN0000222576 GCAATTCAGAAAGGGTTGTTT pLKO.1 1007 CDS 100% 5.625 4.500 N MARCHF7 n/a
6 TRCN0000365349 AGCACACGTGTCCGATTTATT pLKO_005 2236 CDS 100% 15.000 10.500 N MARCHF7 n/a
7 TRCN0000365420 ATGCTATATGGCACCTAATTA pLKO_005 2766 3UTR 100% 15.000 10.500 N MARCHF7 n/a
8 TRCN0000370532 CATGATCACAGTAGATATTAT pLKO_005 1743 CDS 100% 15.000 10.500 N MARCHF7 n/a
9 TRCN0000365352 ACAGATTCCTCTATTAGTAAT pLKO_005 691 CDS 100% 13.200 9.240 N MARCHF7 n/a
10 TRCN0000370473 ACATAGCAAATCCGATGTTTA pLKO_005 2557 3UTR 100% 13.200 9.240 N MARCHF7 n/a
11 TRCN0000365351 TCAATGGTACTTGGATCATTT pLKO_005 628 CDS 100% 13.200 9.240 N MARCHF7 n/a
12 TRCN0000222575 CCTGGTTCCTTATTCCGGTTT pLKO.1 1681 CDS 100% 4.050 2.835 N MARCHF7 n/a
13 TRCN0000377555 GCTTCACAGTCCCGTAGTAAT pLKO_005 1210 CDS 100% 13.200 7.920 N MARCHF7 n/a
14 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4435 3UTR 100% 4.050 2.025 Y P3H4 n/a
15 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4435 3UTR 100% 4.050 2.025 Y ORAI2 n/a
16 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4435 3UTR 100% 4.050 2.025 Y P3H4 n/a
17 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4563 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282805.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08875 pDONR223 100% 99.9% 100% None 651C>T;1467T>C n/a
2 ccsbBroad304_08875 pLX_304 0% 99.9% 100% V5 651C>T;1467T>C n/a
3 TRCN0000477739 ATCGCGTGGAGATTTTCCGCGTAA pLX_317 21.6% 99.9% 100% V5 651C>T;1467T>C n/a
Download CSV