Transcript: Human NM_001316893.2

Homo sapiens PRH1-TAS2R14 readthrough (PRH1-TAS2R14), mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
PRH1-TAS2R14 (106707243)
Length:
1698
CDS:
324..854

Additional Resources:

NCBI RefSeq record:
NM_001316893.2
NBCI Gene record:
PRH1-TAS2R14 (106707243)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001316893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014041 GATCACTTTCTTCCTACTCTA pLKO.1 599 CDS 100% 4.950 2.475 Y TAS2R14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489874 TGTGGACACTCCTGTGGGTATCTT pLX_317 36.8% 45.2% 38.5% V5 (many diffs) n/a
2 TRCN0000489521 GACCTATCAATTGGCACGATGACC pLX_317 43.6% 45.2% 38.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_08187 pDONR223 100% 45.1% 38.5% None (many diffs) n/a
4 ccsbBroad304_08187 pLX_304 0% 45.1% 38.5% V5 (many diffs) n/a
5 TRCN0000474641 CACTTAGAGAGCGAGCTATGGTCC pLX_317 48.9% 45% 38.2% V5 (many diffs) n/a
Download CSV