Transcript: Human NR_110578.2

Homo sapiens casein kinase 1 delta (CSNK1D), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CSNK1D (1453)
Length:
3572
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110578.2
NBCI Gene record:
CSNK1D (1453)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_110578.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000597 CCCATCGAAGTGTTGTGTAAA pLKO.1 846 3UTR 100% 13.200 18.480 N CSNK1D n/a
2 TRCN0000001550 CCCATCGAAGTGTTGTGTAAA pLKO.1 846 3UTR 100% 13.200 18.480 N CSNK1D n/a
3 TRCN0000279939 CCGATGAGAACTCTCCTTATT pLKO_005 1446 3UTR 100% 13.200 18.480 N CSNK1D n/a
4 TRCN0000199409 CCACGTGAACTCGGTTGTAAC pLKO.1 1662 3UTR 100% 10.800 15.120 N CSNK1D n/a
5 TRCN0000361946 CTCTGTTACCAATGGCTTTAC pLKO_005 1500 3UTR 100% 10.800 15.120 N Csnk1d n/a
6 TRCN0000322284 TCTATCTCGGTACGGACATTG pLKO_005 437 3UTR 100% 10.800 15.120 N Csnk1d n/a
7 TRCN0000023771 CCTCACAGAATAGCATTCCTT pLKO.1 1330 3UTR 100% 3.000 4.200 N Csnk1d n/a
8 TRCN0000010640 GTCCACCTCACAGAATAGCAT pLKO.1 1325 3UTR 100% 3.000 4.200 N CSNK1D n/a
9 TRCN0000279937 GTCCACCTCACAGAATAGCAT pLKO_005 1325 3UTR 100% 3.000 4.200 N CSNK1D n/a
10 TRCN0000000598 CGAAAGGATTAGCGAGAAGAA pLKO.1 815 3UTR 100% 4.950 3.960 N CSNK1D n/a
11 TRCN0000001551 CGAAAGGATTAGCGAGAAGAA pLKO.1 815 3UTR 100% 4.950 3.960 N CSNK1D n/a
12 TRCN0000279875 CGAAAGGATTAGCGAGAAGAA pLKO_005 815 3UTR 100% 4.950 3.960 N CSNK1D n/a
13 TRCN0000000600 CGAAGTGTTGTGTAAAGGCTA pLKO.1 851 3UTR 100% 2.640 2.112 N CSNK1D n/a
14 TRCN0000001553 CGAAGTGTTGTGTAAAGGCTA pLKO.1 851 3UTR 100% 2.640 2.112 N CSNK1D n/a
15 TRCN0000322349 ATTTGCCACATACCTGAATTT pLKO_005 881 3UTR 100% 13.200 9.240 N Csnk1d n/a
16 TRCN0000322282 ATGGCTGATCTACTCTGTTAC pLKO_005 1488 3UTR 100% 10.800 7.560 N Csnk1d n/a
17 TRCN0000000601 CGAATTTGCCACATACCTGAA pLKO.1 878 3UTR 100% 4.050 2.835 N CSNK1D n/a
18 TRCN0000023769 CCTGAATTTCTGCCGTTCCTT pLKO.1 893 3UTR 100% 3.000 2.100 N Csnk1d n/a
19 TRCN0000194725 CCAATGGCTTTACTAGTGACA pLKO.1 1508 3UTR 100% 0.000 0.000 N CSNK1D n/a
20 TRCN0000000599 CCAAGAGACAGAAATACGAAA pLKO.1 799 3UTR 100% 4.950 2.970 N CSNK1D n/a
21 TRCN0000001552 CCAAGAGACAGAAATACGAAA pLKO.1 799 3UTR 100% 4.950 2.970 N CSNK1D n/a
22 TRCN0000297740 CCAAGAGACAGAAATACGAAA pLKO_005 799 3UTR 100% 4.950 2.970 N CSNK1D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110578.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06056 pDONR223 100% 26.7% None (many diffs) n/a
2 ccsbBroad304_06056 pLX_304 0% 26.7% V5 (many diffs) n/a
3 TRCN0000479473 AGTTACCGTGACGGCATGCCTGAA pLX_317 18.4% 26.7% V5 (many diffs) n/a
4 ccsbBroadEn_14600 pDONR223 0% 26.7% None (many diffs) n/a
5 ccsbBroad304_14600 pLX_304 0% 26.7% V5 (many diffs) n/a
6 TRCN0000479372 TAGGCGTCATCTCCCTCATAAACC pLX_317 18.4% 26.7% V5 (many diffs) n/a
7 TRCN0000488055 CATAGAACCCGCCGCCGAGCCGTC pLX_317 17.5% 26.7% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_00378 pDONR223 100% 26.2% None 1_369del;703_704ins229;1368_3572del n/a
9 ccsbBroad304_00378 pLX_304 0% 26.2% V5 1_369del;703_704ins229;1368_3572del n/a
10 TRCN0000467149 GTTCAACACCCCCACCGCCAACGT pLX_317 16.9% 26.2% V5 1_369del;703_704ins229;1368_3572del n/a
11 TRCN0000487884 GTGCGCCGACGAAGTCCCGTACGG pLX_317 16.7% 26.2% V5 1_369del;703_704ins229;1368_3572delinsG n/a
12 TRCN0000487781 TATCAACCTAAGCCATCACCAAAC pLX_317 17.1% 26.2% V5 (not translated due to prior stop codon) 1_369del;703_704ins229;1368_3572del n/a
Download CSV