Transcript: Human NM_001323627.2

Homo sapiens zinc finger DHHC-type containing 1 (ZDHHC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ZDHHC1 (29800)
Length:
2252
CDS:
346..1794

Additional Resources:

NCBI RefSeq record:
NM_001323627.2
NBCI Gene record:
ZDHHC1 (29800)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323627.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437084 GAGGAAGAGGCGCGTGTATAA pLKO_005 1455 CDS 100% 13.200 18.480 N ZDHHC1 n/a
2 TRCN0000130022 GCTTCCACATTTATCTCATGT pLKO.1 1142 CDS 100% 4.950 6.930 N ZDHHC1 n/a
3 TRCN0000121372 CCTGCTCTGCTTCCACATTTA pLKO.1 1134 CDS 100% 13.200 9.240 N Zdhhc1 n/a
4 TRCN0000130583 CCTGCTCTGCTTCCACATTTA pLKO.1 1134 CDS 100% 13.200 9.240 N ZDHHC1 n/a
5 TRCN0000425576 ACAGTGTTGCATCCGCTTTAC pLKO_005 887 CDS 100% 10.800 7.560 N ZDHHC1 n/a
6 TRCN0000127933 CAGCACGCACATGTCATTGAA pLKO.1 721 CDS 100% 5.625 3.938 N ZDHHC1 n/a
7 TRCN0000146418 CATTCAGGAGATGGAGTTCTA pLKO.1 1266 CDS 100% 4.950 3.465 N ZDHHC1 n/a
8 TRCN0000148361 CTTCGTGGAGTTCTTTGTCAA pLKO.1 945 CDS 100% 4.950 3.465 N ZDHHC1 n/a
9 TRCN0000146909 CATTTATCTCATGTGGCACAA pLKO.1 1149 CDS 100% 4.050 2.835 N ZDHHC1 n/a
10 TRCN0000438453 TGATCGGCTTTGGGATCCTTG pLKO_005 536 CDS 100% 4.050 2.835 N ZDHHC1 n/a
11 TRCN0000127495 CAAGTGGCTCAACAACTGTGT pLKO.1 837 CDS 100% 2.640 1.848 N ZDHHC1 n/a
12 TRCN0000148396 CACATATGTCTTCGTGGAGTT pLKO.1 936 CDS 100% 0.000 0.000 N ZDHHC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323627.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03094 pDONR223 100% 89.5% 69% None (many diffs) n/a
2 ccsbBroad304_03094 pLX_304 0% 89.5% 69% V5 (many diffs) n/a
3 TRCN0000477634 ATTCTTTCTGAAAAATAACACTAC pLX_317 15.7% 89.5% 69% V5 (many diffs) n/a
Download CSV