Transcript: Human NM_130768.3

Homo sapiens ankyrin repeat, SAM and basic leucine zipper domain containing 1 (ASZ1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ASZ1 (136991)
Length:
1835
CDS:
34..1461

Additional Resources:

NCBI RefSeq record:
NM_130768.3
NBCI Gene record:
ASZ1 (136991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_130768.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414728 ACTGTTTGCAGCACAATATAA pLKO_005 1527 3UTR 100% 15.000 10.500 N ASZ1 n/a
2 TRCN0000423563 AGAGGACAGCTATTACCATAT pLKO_005 1388 CDS 100% 10.800 7.560 N ASZ1 n/a
3 TRCN0000128986 GAACAGATCTTGAAGTGTGTA pLKO.1 409 CDS 100% 4.950 3.465 N ASZ1 n/a
4 TRCN0000131236 GCAATGACCATCGGAGATGTT pLKO.1 190 CDS 100% 4.950 3.465 N ASZ1 n/a
5 TRCN0000127928 CAAGCTAACTTTCCAGAGGAA pLKO.1 1437 CDS 100% 2.640 1.848 N ASZ1 n/a
6 TRCN0000130485 GAGATACAATTTGGAGAGCTA pLKO.1 1042 CDS 100% 2.640 1.848 N ASZ1 n/a
7 TRCN0000129402 GCAAGCTAACTTTCCAGAGGA pLKO.1 1436 CDS 100% 2.640 1.848 N ASZ1 n/a
8 TRCN0000130915 GCAGAAGTTAATACCCAGGAT pLKO.1 550 CDS 100% 2.640 1.848 N ASZ1 n/a
9 TRCN0000084921 CCCAGGATGAGAATGGTTATA pLKO.1 563 CDS 100% 13.200 9.240 N Asz1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130768.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04908 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04908 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473096 CGTTCCGGTTGCCCGATATTTGGA pLX_317 35.7% 100% 100% V5 n/a
4 ccsbBroadEn_10548 pDONR223 100% 82.3% 81.4% None (many diffs) n/a
5 ccsbBroad304_10548 pLX_304 0% 82.3% 81.4% V5 (many diffs) n/a
6 TRCN0000491826 AACGGTTTTCCCCCTAGATCGGAA pLX_317 11.4% 82.3% 81.4% V5 (many diffs) n/a
Download CSV