Transcript: Mouse NM_033580.3

Mus musculus protocadherin gamma subfamily B, 8 (Pcdhgb8), transcript variant 1, coding, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Mus musculus (mouse)
Gene:
Pcdhgb8 (93705)
Length:
3234
CDS:
79..2874

Additional Resources:

NCBI RefSeq record:
NM_033580.3
NBCI Gene record:
Pcdhgb8 (93705)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094921 CGTGGTGATAGAAGATATAAA pLKO.1 441 CDS 100% 15.000 21.000 N Pcdhgb8 n/a
2 TRCN0000094920 GCGTGGTGATAGAAGATATAA pLKO.1 440 CDS 100% 15.000 21.000 N Pcdhgb8 n/a
3 TRCN0000094922 CCTTAGAGTTATTGCAGAGAA pLKO.1 276 CDS 100% 4.950 3.465 N Pcdhgb8 n/a
4 TRCN0000094923 GCCAGCAATTACTATAAGCTT pLKO.1 1273 CDS 100% 3.000 2.100 N Pcdhgb8 n/a
5 TRCN0000094769 CCTATTCAATCAGTGATTGTA pLKO.1 3096 3UTR 100% 5.625 2.813 Y Pcdhgc4 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3161 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01151 pDONR223 100% 13% 13.4% None (many diffs) n/a
2 ccsbBroad304_01151 pLX_304 0% 13% 13.4% V5 (many diffs) n/a
3 TRCN0000466539 CATGGTTCGGTAATGAAAGTTCCA pLX_317 36.4% 13% 13.4% V5 (many diffs) n/a
4 ccsbBroadEn_11019 pDONR223 100% 5.8% 6.4% None (many diffs) n/a
5 ccsbBroad304_11019 pLX_304 0% 5.8% 6.4% V5 (many diffs) n/a
Download CSV