Transcript: Human XM_005245878.5

PREDICTED: Homo sapiens heterochromatin protein 1 binding protein 3 (HP1BP3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HP1BP3 (50809)
Length:
4299
CDS:
518..2179

Additional Resources:

NCBI RefSeq record:
XM_005245878.5
NBCI Gene record:
HP1BP3 (50809)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245878.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276321 ACTCGCCTTTGTGAACCTAAA pLKO_005 1319 CDS 100% 10.800 15.120 N HP1BP3 n/a
2 TRCN0000180320 CCTAAGGCACTCCCACTTATA pLKO.1 554 CDS 100% 13.200 10.560 N HP1BP3 n/a
3 TRCN0000285533 GGAGTCATCAAACAGGTTAAA pLKO_005 1157 CDS 100% 13.200 9.240 N HP1BP3 n/a
4 TRCN0000183660 CAATCTTAACTGAGGCCATTA pLKO.1 1005 CDS 100% 10.800 7.560 N HP1BP3 n/a
5 TRCN0000285534 CAATCTTAACTGAGGCCATTA pLKO_005 1005 CDS 100% 10.800 7.560 N HP1BP3 n/a
6 TRCN0000276322 TTTAGGCATTTGCTAGCTTTA pLKO_005 2325 3UTR 100% 10.800 7.560 N HP1BP3 n/a
7 TRCN0000146891 CCAGGAACCAATTCTAACTAT pLKO.1 1634 CDS 100% 5.625 3.938 N HP1BP3 n/a
8 TRCN0000093005 CCTGATGGAATATGCAATCTT pLKO.1 1537 CDS 100% 5.625 3.938 N Hp1bp3 n/a
9 TRCN0000183774 CCTGATGGAATATGCAATCTT pLKO.1 1537 CDS 100% 5.625 3.938 N HP1BP3 n/a
10 TRCN0000323654 CCTGATGGAATATGCAATCTT pLKO_005 1537 CDS 100% 5.625 3.938 N Hp1bp3 n/a
11 TRCN0000178988 CCACAGTCATCAAGAAACCTA pLKO.1 2055 CDS 100% 3.000 2.100 N HP1BP3 n/a
12 TRCN0000276323 CCACAGTCATCAAGAAACCTA pLKO_005 2055 CDS 100% 3.000 2.100 N HP1BP3 n/a
13 TRCN0000148219 GTTAGAACAGATAACTGGCAA pLKO.1 1456 CDS 100% 2.640 1.848 N HP1BP3 n/a
14 TRCN0000093004 GCGGACAAGTTAGGTGAGAAA pLKO.1 596 CDS 100% 4.950 6.930 N Hp1bp3 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3148 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 2981 3UTR 100% 4.950 2.475 Y C16orf89 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3148 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245878.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11931 pDONR223 100% 61% 59.5% None (many diffs) n/a
2 ccsbBroad304_11931 pLX_304 0% 61% 59.5% V5 (many diffs) n/a
3 TRCN0000475906 TGTTAGCCCTAACAGGCATTAGTT pLX_317 31.3% 61% 59.5% V5 (many diffs) n/a
4 ccsbBroadEn_11930 pDONR223 100% 23.2% 20.9% None (many diffs) n/a
5 ccsbBroad304_11930 pLX_304 0% 23.2% 20.9% V5 (many diffs) n/a
6 TRCN0000466494 ATCCCGCCTCGGCCAGTAGTTGTC pLX_317 88.7% 23.2% 20.9% V5 (many diffs) n/a
Download CSV