Transcript: Human XM_005258463.4

PREDICTED: Homo sapiens heterogeneous nuclear ribonucleoprotein U like 1 (HNRNPUL1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HNRNPUL1 (11100)
Length:
3637
CDS:
281..2581

Additional Resources:

NCBI RefSeq record:
XM_005258463.4
NBCI Gene record:
HNRNPUL1 (11100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005258463.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074731 CCGTGTATGCTTCGAGATGAA pLKO.1 745 CDS 100% 4.950 6.930 N HNRNPUL1 n/a
2 TRCN0000298251 CCGTGTATGCTTCGAGATGAA pLKO_005 745 CDS 100% 4.950 6.930 N HNRNPUL1 n/a
3 TRCN0000074730 CCGGGATAACAACAACTCCAA pLKO.1 2008 CDS 100% 2.640 3.696 N HNRNPUL1 n/a
4 TRCN0000333556 CCGGGATAACAACAACTCCAA pLKO_005 2008 CDS 100% 2.640 3.696 N HNRNPUL1 n/a
5 TRCN0000074729 CCCGCAAGAAACGCAACTATA pLKO.1 1467 CDS 100% 13.200 9.240 N HNRNPUL1 n/a
6 TRCN0000344784 CCTCATGCAGTTGGTTGTAAA pLKO_005 2976 3UTR 100% 13.200 9.240 N HNRNPUL1 n/a
7 TRCN0000074732 GCCCGCAAGAAACGCAACTAT pLKO.1 1466 CDS 100% 5.625 3.938 N HNRNPUL1 n/a
8 TRCN0000286699 GCCCGCAAGAAACGCAACTAT pLKO_005 1466 CDS 100% 5.625 3.938 N HNRNPUL1 n/a
9 TRCN0000074728 GCTTCTGTGTTCAGTTGAATT pLKO.1 3321 3UTR 100% 0.000 0.000 N HNRNPUL1 n/a
10 TRCN0000295096 TACCCTCAGCCCAGCTATAAC pLKO_005 2432 CDS 100% 0.000 0.000 N Hnrnpul1 n/a
11 TRCN0000123481 GCCTACAACTATGGGAGCTAT pLKO.1 2357 CDS 100% 4.950 6.930 N Hnrnpul1 n/a
12 TRCN0000287568 GCCTACAACTATGGGAGCTAT pLKO_005 2357 CDS 100% 4.950 6.930 N Hnrnpul1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005258463.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07749 pDONR223 100% 98.6% 98.5% None 4G>A;1960_1989del;2142T>C n/a
2 ccsbBroad304_07749 pLX_304 0% 98.6% 98.5% V5 4G>A;1960_1989del;2142T>C n/a
3 TRCN0000480328 TTATTAAAAGCTTTGCAGTCAATT pLX_317 17.1% 98.6% 98.5% V5 4G>A;1960_1989del;2142T>C n/a
4 ccsbBroadEn_07750 pDONR223 99.6% 87.2% 87.2% None 0_1ins300;1960_1989del;2142T>C n/a
5 ccsbBroad304_07750 pLX_304 0% 87.2% 87.2% V5 0_1ins300;1960_1989del;2142T>C n/a
6 TRCN0000474866 CGACCAATATAGTCTTGACAGAGT pLX_317 17.8% 87.2% 87.2% V5 0_1ins300;1960_1989del;2142T>C n/a
7 ccsbBroadEn_11594 pDONR223 100% 81.2% 81.2% None 0_1ins300;1791A>G;1958_2143del n/a
8 ccsbBroad304_11594 pLX_304 0% 81.2% 81.2% V5 0_1ins300;1791A>G;1958_2143del n/a
9 TRCN0000471325 CGGTCTCGAGCTGCCTTCAGGCTC pLX_317 9.8% 81.2% 81.2% V5 0_1ins300;1791A>G;1958_2143del n/a
10 ccsbBroadEn_15738 pDONR223 0% 14.5% 2.3% None (many diffs) n/a
11 ccsbBroad304_15738 pLX_304 0% 14.5% 2.3% V5 (many diffs) n/a
12 TRCN0000478396 CATTCTCCTGGGCCGTCTGAAATT pLX_317 78.7% 14.5% 2.3% V5 (many diffs) n/a
Download CSV