Transcript: Human XM_005266491.5

PREDICTED: Homo sapiens RNA binding motif protein 26 (RBM26), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBM26 (64062)
Length:
6766
CDS:
237..3305

Additional Resources:

NCBI RefSeq record:
XM_005266491.5
NBCI Gene record:
RBM26 (64062)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266491.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294105 TGGAATAAACCAGTAACTAAT pLKO_005 3150 CDS 100% 13.200 18.480 N RBM26 n/a
2 TRCN0000074523 GCTTAGGCTTTACTATGTATT pLKO.1 3779 3UTR 100% 13.200 9.240 N RBM26 n/a
3 TRCN0000294104 CACTACCCTGTACCTACTTTG pLKO_005 969 CDS 100% 10.800 7.560 N RBM26 n/a
4 TRCN0000074527 CCCAACAGTTACAAACTACTT pLKO.1 2107 CDS 100% 4.950 3.465 N RBM26 n/a
5 TRCN0000286696 CCCAACAGTTACAAACTACTT pLKO_005 2107 CDS 100% 4.950 3.465 N RBM26 n/a
6 TRCN0000074526 GCTCGTTTCAAAGGGCAAGAT pLKO.1 3117 CDS 100% 4.950 3.465 N RBM26 n/a
7 TRCN0000074524 GCAGTATTAAACAATCGCTTT pLKO.1 2055 CDS 100% 4.050 2.835 N RBM26 n/a
8 TRCN0000286695 GCAGTATTAAACAATCGCTTT pLKO_005 2055 CDS 100% 4.050 2.835 N RBM26 n/a
9 TRCN0000074525 CCTGGATAGAACAGATCCATT pLKO.1 899 CDS 100% 0.495 0.347 N RBM26 n/a
10 TRCN0000294099 TACCTGTGTTTCATTAGTATT pLKO_005 3341 3UTR 100% 0.000 0.000 N RBM26 n/a
11 TRCN0000305476 TACCTGTGTTTCATTAGTATT pLKO_005 3341 3UTR 100% 0.000 0.000 N Rbm26 n/a
12 TRCN0000123588 GCTGTGAATACAAAGAGTTAT pLKO.1 459 CDS 100% 13.200 9.240 N Rbm26 n/a
13 TRCN0000332086 GCTGTGAATACAAAGAGTTAT pLKO_005 459 CDS 100% 13.200 9.240 N Rbm26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266491.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12441 pDONR223 100% 96.1% 96.1% None 1132_1161del;1304_1318del;2030_2101del n/a
2 ccsbBroad304_12441 pLX_304 0% 96.1% 96.1% V5 1132_1161del;1304_1318del;2030_2101del n/a
3 ccsbBroadEn_03915 pDONR223 100% 95.8% 95.8% None (many diffs) n/a
4 ccsbBroad304_03915 pLX_304 0% 95.8% 95.8% V5 (many diffs) n/a
5 TRCN0000481379 GGCTGCTAGGCGCTCCTTCTGTTC pLX_317 15.8% 95.8% 95.8% V5 (many diffs) n/a
6 ccsbBroadEn_12440 pDONR223 100% 5.9% 1.5% None 1_2647del;2831_3066del n/a
7 ccsbBroad304_12440 pLX_304 0% 5.9% 1.5% V5 1_2647del;2831_3066del n/a
8 TRCN0000466594 ATTCCAGTTGGGATTATAACAGCG pLX_317 100% 5.9% 1.5% V5 1_2647del;2831_3066del n/a
Download CSV