Transcript: Human XM_005268810.1

PREDICTED: Homo sapiens TANK binding kinase 1 (TBK1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBK1 (29110)
Length:
3142
CDS:
220..2409

Additional Resources:

NCBI RefSeq record:
XM_005268810.1
NBCI Gene record:
TBK1 (29110)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148392 ACAGTGTATAAACTCCCACA pXPR_003 TGG 273 12% 4 1.5039 TBK1 TBK1 76362
2 BRDN0001145663 AATCAAGAACTTATCTACGA pXPR_003 AGG 1061 48% 9 0.2745 TBK1 TBK1 76361
3 BRDN0001148607 AGTTGATCTTTGGAGCATTG pXPR_003 GGG 619 28% 6 0.1433 TBK1 TBK1 76363
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268810.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003185 GCGGCAGAGTTAGGTGAAATT pLKO.1 1693 CDS 100% 13.200 18.480 N TBK1 n/a
2 TRCN0000314840 GCGGCAGAGTTAGGTGAAATT pLKO_005 1693 CDS 100% 13.200 18.480 N TBK1 n/a
3 TRCN0000003182 GCAGAACGTAGATTAGCTTAT pLKO.1 1930 CDS 100% 10.800 15.120 N TBK1 n/a
4 TRCN0000314787 GCAGAACGTAGATTAGCTTAT pLKO_005 1930 CDS 100% 10.800 15.120 N TBK1 n/a
5 TRCN0000003186 CGGGAACCTCTGAATACCATA pLKO.1 1369 CDS 100% 4.950 6.930 N TBK1 n/a
6 TRCN0000314839 CGGGAACCTCTGAATACCATA pLKO_005 1369 CDS 100% 4.950 6.930 N TBK1 n/a
7 TRCN0000380974 GGATATCGACAGCAGATTATC pLKO_005 1779 CDS 100% 13.200 10.560 N TBK1 n/a
8 TRCN0000314842 ATTTGATGTGGTCGTGTAAAT pLKO_005 2514 3UTR 100% 13.200 9.240 N TBK1 n/a
9 TRCN0000314841 TGGTATAGTGCACCGTGATAT pLKO_005 606 CDS 100% 13.200 9.240 N TBK1 n/a
10 TRCN0000196717 GCTAGAGAATTAGAAGATGAT pLKO.1 700 CDS 100% 4.950 3.465 N TBK1 n/a
11 TRCN0000003183 GTATTTGATGTGGTCGTGTAA pLKO.1 2512 3UTR 100% 4.950 3.465 N TBK1 n/a
12 TRCN0000003184 CCAGGAAATATCATGCGTGTT pLKO.1 631 CDS 100% 4.050 2.835 N TBK1 n/a
13 TRCN0000199632 GCCTGTTTCTTGCAGTCTTTC pLKO.1 1008 CDS 100% 10.800 6.480 N TBK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268810.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488336 GCGGACAACATAGATTCGGCTTGC pLX_317 15.9% 99.9% 100% V5 978T>A n/a
2 TRCN0000489401 ATTTTTCATCCTTTACTTGGCCGT pLX_317 17% 99.9% 100% V5 (not translated due to prior stop codon) 978T>A n/a
3 ccsbBroadEn_08116 pDONR223 100% 99.8% 99.7% None 978T>A;1162A>G;1708A>C n/a
4 ccsbBroad304_08116 pLX_304 31% 99.8% 99.7% V5 978T>A;1162A>G;1708A>C n/a
5 TRCN0000475435 AGGCTGTCTGTAGTGTTCATCTCG pLX_317 25.6% 99.8% 99.7% V5 978T>A;1162A>G;1708A>C n/a
6 ccsbBroadEn_15050 pDONR223 0% 99.8% 99.7% None 978T>A;1162A>G;1708A>C n/a
7 ccsbBroad304_15050 pLX_304 29.1% 99.8% 99.7% V5 978T>A;1162A>G;1708A>C n/a
8 TRCN0000475133 TCCACATGCAAACATATCTACTCA pLX_317 25.8% 99.8% 99.7% V5 978T>A;1162A>G;1708A>C n/a
Download CSV