Transcript: Human XM_005270198.1

PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAMK2G (818)
Length:
3830
CDS:
122..1813

Additional Resources:

NCBI RefSeq record:
XM_005270198.1
NBCI Gene record:
CAMK2G (818)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148688 CCAGAATCTGATGTATACAG pXPR_003 TGG 347 21% 6 0.9129 CAMK2G CAMK2G 76237
2 BRDN0001147974 CTCAGGGGACAAGTAACCTG pXPR_003 GGG 535 32% 8 0.7345 CAMK2G CAMK2G 76239
3 BRDN0001148569 CTTCTGAAACATCCAAACAT pXPR_003 CGG 215 13% 3 0.1244 CAMK2G CAMK2G 76238
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270198.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380821 GGTTTCACTACCTCGTGTTTG pLKO_005 372 CDS 100% 10.800 15.120 N CAMK2G n/a
2 TRCN0000217973 TATCCATACCACCATCCTAAA pLKO_005 1603 CDS 100% 10.800 15.120 N CAMK2G n/a
3 TRCN0000199725 GCTCGGATATGTCGACTTCTG pLKO.1 305 CDS 100% 4.050 5.670 N CAMK2G n/a
4 TRCN0000000480 GATCACCAGAAACTAGAACGT pLKO.1 281 CDS 100% 2.640 3.696 N CAMK2G n/a
5 TRCN0000000476 CGTTGCTGTACTGTCTTGTTT pLKO.1 2457 3UTR 100% 5.625 4.500 N CAMK2G n/a
6 TRCN0000379741 GGGATGGATTTCCATAAGTTT pLKO_005 1547 CDS 100% 5.625 4.500 N CAMK2G n/a
7 TRCN0000000479 ACACAACGCTACAGATGGGAT pLKO.1 1222 CDS 100% 2.640 2.112 N CAMK2G n/a
8 TRCN0000194892 CCTGTTTGTTTGAGGTTTAAA pLKO.1 1902 3UTR 100% 15.000 10.500 N CAMK2G n/a
9 TRCN0000382449 GCAGATGCCAGCCACTGTATA pLKO_005 452 CDS 100% 13.200 9.240 N CAMK2G n/a
10 TRCN0000218136 TCAGATTCTGGAGAGTGTTAA pLKO_005 475 CDS 100% 13.200 9.240 N CAMK2G n/a
11 TRCN0000217949 TCCTGTTTGTTTGAGGTTTAA pLKO_005 1901 3UTR 100% 13.200 9.240 N CAMK2G n/a
12 TRCN0000382137 ACAGGAGATCATTAAGATTAC pLKO_005 1417 CDS 100% 10.800 7.560 N CAMK2G n/a
13 TRCN0000226387 AGAACGTGAGGCTCGGATATG pLKO_005 295 CDS 100% 10.800 7.560 N CAMK2G n/a
14 TRCN0000381254 AGTGTTTGCGCAAGTTCAATG pLKO_005 987 CDS 100% 10.800 7.560 N CAMK2G n/a
15 TRCN0000380867 CGACTTCTGAAACATCCAAAC pLKO_005 317 CDS 100% 6.000 4.200 N CAMK2G n/a
16 TRCN0000000477 ACCTCGTGTTTGACCTTGTTA pLKO.1 381 CDS 100% 5.625 3.938 N CAMK2G n/a
17 TRCN0000024180 CCTGAGGTCTTGAGGAAAGAT pLKO.1 668 CDS 100% 5.625 3.938 N Camk2g n/a
18 TRCN0000381095 AGCTTGGCAAGGGTGCTTTCT pLKO_005 177 CDS 100% 4.950 3.465 N CAMK2G n/a
19 TRCN0000381780 GATGGCAAGTGGCTCAATGTC pLKO_005 1751 CDS 100% 4.950 3.465 N CAMK2G n/a
20 TRCN0000380898 TGAGAATCTCCTGTCCAAGAA pLKO_005 1573 CDS 100% 4.950 3.465 N CAMK2G n/a
21 TRCN0000381357 TGCTTGTCTCCAGGAACTTCT pLKO_005 1044 CDS 100% 4.950 3.465 N CAMK2G n/a
22 TRCN0000381137 ACGCTACAGATGGGATCAAGG pLKO_005 1227 CDS 100% 4.050 2.835 N CAMK2G n/a
23 TRCN0000226388 TTGAGGCCTACACGAAGATTT pLKO_005 1473 CDS 100% 13.200 7.920 N CAMK2G n/a
24 TRCN0000361100 TTGAGGCCTACACGAAGATTT pLKO_005 1473 CDS 100% 13.200 7.920 N Camk2g n/a
25 TRCN0000382069 AGGATCAGCACAAGCTGTATC pLKO_005 771 CDS 100% 10.800 6.480 N CAMK2G n/a
26 TRCN0000000478 AGAACAGCAAGCCTATCCATA pLKO.1 1590 CDS 100% 4.950 2.970 N CAMK2G n/a
27 TRCN0000024181 CAAGCCACAGAGCAACAACAA pLKO.1 1171 CDS 100% 4.950 2.970 N Camk2g n/a
28 TRCN0000024182 GAGGATCAGCACAAGCTGTAT pLKO.1 770 CDS 100% 4.950 2.970 N Camk2g n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270198.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14566 pDONR223 100% 85.6% 44.4% None (many diffs) n/a
2 ccsbBroad304_14566 pLX_304 0% 85.6% 44.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000480621 AAGACTGTGGCACCAACTCCCGCC pLX_317 29.4% 85.6% 44.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488486 GACCTCCTCAAGAGGCAACGCTGC pLX_317 10.9% 72.5% 80% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489411 AAGTGGCATAGCCCCCTCAAGCTG pLX_317 20.6% 72.5% 79.8% V5 (many diffs) n/a
6 ccsbBroadEn_14563 pDONR223 93.6% 71.3% 78.8% None (many diffs) n/a
7 ccsbBroad304_14563 pLX_304 0% 71.3% 78.8% V5 (many diffs) n/a
8 TRCN0000468031 AGCATTTCATGGTGGACCTTTAGT pLX_317 28.9% 68.7% 75.8% V5 (not translated due to frame shift) (many diffs) n/a
9 ccsbBroadEn_14564 pDONR223 0% 71.3% 78.8% None (many diffs) n/a
10 ccsbBroad304_14564 pLX_304 0% 71.3% 78.8% V5 (many diffs) n/a
11 TRCN0000480225 GACAGTGGGGGTGATCTCGGAGCG pLX_317 22.3% 71.3% 78.8% V5 (many diffs) n/a
Download CSV