Transcript: Human XM_005270782.5

PREDICTED: Homo sapiens glutathione S-transferase mu 1 (GSTM1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GSTM1 (2944)
Length:
1204
CDS:
200..754

Additional Resources:

NCBI RefSeq record:
XM_005270782.5
NBCI Gene record:
GSTM1 (2944)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270782.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083699 CCAGACCATGGACAACCATAT pLKO.1 403 CDS 100% 10.800 7.560 N GSTM1 n/a
2 TRCN0000083700 CCCAAGACCTGTGTTCTCAAA pLKO.1 709 CDS 100% 4.950 2.970 N GSTM1 n/a
3 TRCN0000083702 CTTCCCAAATCTGAAGGACTT pLKO.1 628 CDS 100% 4.050 2.430 N GSTM1 n/a
4 TRCN0000178757 CTTCCCAAATCTGAAGGACTT pLKO.1 628 CDS 100% 4.050 2.430 N GSTM4 n/a
5 TRCN0000083698 CGTTCCTTTCTCCTGTTTATT pLKO.1 854 3UTR 100% 15.000 7.500 Y GSTM1 n/a
6 TRCN0000148357 CGTTCCTTTCTCCTGTTTATT pLKO.1 854 3UTR 100% 15.000 7.500 Y GSTM4 n/a
7 TRCN0000151859 CGTTCCTTTCTCCTGTTTATT pLKO.1 854 3UTR 100% 15.000 7.500 Y GSTM2 n/a
8 TRCN0000280824 CGTTCCTTTCTCCTGTTTATT pLKO_005 854 3UTR 100% 15.000 7.500 Y GSTM4 n/a
9 TRCN0000420215 AGAAGATTCGTGTGGACATTT pLKO_005 375 CDS 100% 13.200 6.600 Y GSTM1 n/a
10 TRCN0000414415 GTGGTTGTGTCTGCTTTAAAG pLKO_005 1037 3UTR 100% 13.200 6.600 Y GSTM1 n/a
11 TRCN0000154339 CCTCGTTCCTTTCTCCTGTTT pLKO.1 851 3UTR 100% 4.950 2.475 Y GSTM2 n/a
12 TRCN0000147236 GAATACACAGACTCAAGCTAT pLKO.1 161 5UTR 100% 4.950 2.475 Y GSTM5 n/a
13 TRCN0000083701 CCACCGTATATTTGAGCCCAA pLKO.1 595 CDS 100% 2.160 1.080 Y GSTM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270782.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13866 pDONR223 100% 77.4% 71.1% None (many diffs) n/a
2 TRCN0000465604 TAACCACCCTTTTATTTACAACGA pLX_317 59.4% 77.4% 71.1% V5 (many diffs) n/a
3 ccsbBroadEn_06334 pDONR223 100% 75.8% 72.4% None (many diffs) n/a
4 ccsbBroad304_06334 pLX_304 0% 75.8% 72.4% V5 (many diffs) n/a
5 TRCN0000471453 CAGTGATATCGATAATGCGTACCT pLX_317 63.9% 75.8% 72.4% V5 (many diffs) n/a
6 ccsbBroadEn_06332 pDONR223 100% 74.9% 69.7% None (many diffs) n/a
7 ccsbBroad304_06332 pLX_304 0% 74.9% 69.7% V5 (many diffs) n/a
8 ccsbBroadEn_00702 pDONR223 100% 67.4% 67.4% None 0_1ins102;353_463del n/a
9 ccsbBroad304_00702 pLX_304 0% 67.4% 67.4% V5 0_1ins102;353_463del n/a
10 TRCN0000469779 ATATGCGTGTAAAATATCACAGCA pLX_317 88% 67.4% 67.4% V5 0_1ins102;353_463del n/a
Download CSV