Transcript: Human XM_005275640.3

PREDICTED: Homo sapiens UDP-glucuronosyltransferase 2B10-like (LOC101929773), partial mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC101929773 (101929773)
Length:
1759
CDS:
1..588

Additional Resources:

NCBI RefSeq record:
XM_005275640.3
NBCI Gene record:
LOC101929773 (101929773)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005275640.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034732 CGAGCAGTCTTCTGGATTGAA pLKO.1 373 CDS 100% 5.625 2.813 Y UGT2B28 n/a
2 TRCN0000036206 CTGGTTCCAGTACCACTCTTT pLKO.1 450 CDS 100% 4.950 2.475 Y UGT2B7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005275640.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01752 pDONR223 100% 35.8% 35.6% None (many diffs) n/a
2 ccsbBroad304_01752 pLX_304 0% 35.8% 35.6% V5 (many diffs) n/a
3 ccsbBroadEn_02514 pDONR223 100% 35.5% 34.7% None (many diffs) n/a
4 ccsbBroad304_02514 pLX_304 0% 35.5% 34.7% V5 (many diffs) n/a
5 ccsbBroadEn_13979 pDONR223 100% 34.7% 33.2% None (many diffs) n/a
6 ccsbBroad304_13979 pLX_304 0% 34.7% 33.2% V5 (not translated due to frame shift) (many diffs) n/a
7 TRCN0000480649 GTATCCTGATATGCGTTGCTGGGC pLX_317 26.8% 34.7% 33.2% V5 (not translated due to frame shift) (many diffs) n/a
8 ccsbBroadEn_10448 pDONR223 100% 33.7% 33% None (many diffs) n/a
9 ccsbBroad304_10448 pLX_304 0% 33.7% 33% V5 (not translated due to frame shift) (many diffs) n/a
10 TRCN0000471029 ATGCGTCAATATGTCCGATAACAC pLX_317 30.6% 33.7% 33% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV