Transcript: Mouse XM_006496878.3

PREDICTED: Mus musculus RAB GTPase activating protein 1-like (Rabgap1l), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rabgap1l (29809)
Length:
8849
CDS:
826..3807

Additional Resources:

NCBI RefSeq record:
XM_006496878.3
NBCI Gene record:
Rabgap1l (29809)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496878.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048388 CGAGATATTCATCGTACATTT pLKO.1 2389 CDS 100% 13.200 18.480 N RABGAP1L n/a
2 TRCN0000289641 CGAGATATTCATCGTACATTT pLKO_005 2389 CDS 100% 13.200 18.480 N RABGAP1L n/a
3 TRCN0000106040 GCCCAAAGATAAACGGGTGTA pLKO.1 1800 CDS 100% 4.050 5.670 N Rabgap1l n/a
4 TRCN0000106041 GCCACTTCTATAAAGGATGAT pLKO.1 751 5UTR 100% 4.950 3.960 N Rabgap1l n/a
5 TRCN0000106042 GCGATGGTCAAGAATCCCTTT pLKO.1 2441 CDS 100% 4.050 3.240 N Rabgap1l n/a
6 TRCN0000315512 GCGATGGTCAAGAATCCCTTT pLKO_005 2441 CDS 100% 4.050 3.240 N Rabgap1l n/a
7 TRCN0000048389 GCCTAAGGATAGAGATAAATT pLKO.1 1533 CDS 100% 15.000 10.500 N RABGAP1L n/a
8 TRCN0000305118 TGCCTAAGGATAGAGATAAAT pLKO_005 1532 CDS 100% 15.000 10.500 N Rabgap1l n/a
9 TRCN0000337484 GGCAGAAGTATGGCAACTATT pLKO_005 2283 CDS 100% 13.200 9.240 N Rabgap1l n/a
10 TRCN0000305183 GTTAGGAAGATGGCACAATAA pLKO_005 2199 CDS 100% 13.200 9.240 N Rabgap1l n/a
11 TRCN0000106043 TGTGAAATTAAAGAGGCAGTA pLKO.1 1351 CDS 100% 4.050 2.835 N Rabgap1l n/a
12 TRCN0000106044 GAGTGTTATTACTCGAGATAT pLKO.1 2376 CDS 100% 0.000 0.000 N Rabgap1l n/a
13 TRCN0000315587 GAGTGTTATTACTCGAGATAT pLKO_005 2376 CDS 100% 0.000 0.000 N Rabgap1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496878.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11431 pDONR223 100% 49.5% 46.7% None (many diffs) n/a
2 ccsbBroad304_11431 pLX_304 0% 49.5% 46.7% V5 (many diffs) n/a
3 TRCN0000478216 ACTTTGCACACAACGTACGGCAGA pLX_317 17.3% 49.5% 46.7% V5 (many diffs) n/a
Download CSV