Transcript: Mouse XM_006497355.3

PREDICTED: Mus musculus GATA binding protein 3 (Gata3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gata3 (14462)
Length:
3224
CDS:
604..1932

Additional Resources:

NCBI RefSeq record:
XM_006497355.3
NBCI Gene record:
Gata3 (14462)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497355.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412782 TCCCGTCCTACTACGGAAACT pLKO_005 779 CDS 100% 4.950 3.960 N Gata3 n/a
2 TRCN0000414815 ATTGCTGAACATTGCATATAA pLKO_005 2211 3UTR 100% 15.000 10.500 N Gata3 n/a
3 TRCN0000417083 CAGTTGTTTGATGCATTTAAA pLKO_005 2411 3UTR 100% 15.000 10.500 N Gata3 n/a
4 TRCN0000085481 GCCTGCGGACTCTACCATAAA pLKO.1 1456 CDS 100% 13.200 9.240 N Gata3 n/a
5 TRCN0000085479 GCTGTACTACAAGCTTCATAA pLKO.1 1626 CDS 100% 13.200 9.240 N Gata3 n/a
6 TRCN0000085478 CCCTGTAATTGTTGTTTGTAT pLKO.1 2677 3UTR 100% 5.625 3.938 N Gata3 n/a
7 TRCN0000085480 CGGATGTAAGTCGAGGCCCAA pLKO.1 1341 CDS 100% 0.720 0.504 N Gata3 n/a
8 TRCN0000085482 GCTCAGTATCCGCTGACGGAA pLKO.1 715 CDS 100% 0.880 0.528 N Gata3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497355.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15425 pDONR223 0% 89.6% 96.3% None (many diffs) n/a
2 ccsbBroad304_15425 pLX_304 0% 89.6% 96.3% V5 (many diffs) n/a
3 TRCN0000478685 GACCACTGTGATCAAGGACACGCC pLX_317 29.2% 89.6% 96.3% V5 (many diffs) n/a
4 ccsbBroadEn_06260 pDONR223 100% 89.4% 95.9% None (many diffs) n/a
5 ccsbBroad304_06260 pLX_304 0% 89.4% 95.9% V5 (many diffs) n/a
6 TRCN0000471782 CTATGGAAGTGACGCACGTAGGCT pLX_317 35.6% 89.4% 95.9% V5 (many diffs) n/a
Download CSV