Transcript: Mouse XM_006507238.3

PREDICTED: Mus musculus aryl hydrocarbon receptor nuclear translocator 2 (Arnt2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arnt2 (11864)
Length:
5932
CDS:
16..2154

Additional Resources:

NCBI RefSeq record:
XM_006507238.3
NBCI Gene record:
Arnt2 (11864)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507238.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096379 CGCTATTATCATGCCATAGAT pLKO.1 2187 3UTR 100% 5.625 7.875 N Arnt2 n/a
2 TRCN0000323726 CGCTATTATCATGCCATAGAT pLKO_005 2187 3UTR 100% 5.625 7.875 N Arnt2 n/a
3 TRCN0000096383 GATGGTGAAGGTCCCAGTAAA pLKO.1 181 CDS 100% 13.200 9.240 N Arnt2 n/a
4 TRCN0000323728 GATGGTGAAGGTCCCAGTAAA pLKO_005 181 CDS 100% 13.200 9.240 N Arnt2 n/a
5 TRCN0000096380 CCACCTGCCTTTGAACAGAAT pLKO.1 762 CDS 100% 4.950 3.465 N Arnt2 n/a
6 TRCN0000323789 CCACCTGCCTTTGAACAGAAT pLKO_005 762 CDS 100% 4.950 3.465 N Arnt2 n/a
7 TRCN0000096382 CCTACTCTGATGAGATCGAGT pLKO.1 1283 CDS 100% 2.640 1.848 N Arnt2 n/a
8 TRCN0000323788 CCTACTCTGATGAGATCGAGT pLKO_005 1283 CDS 100% 2.640 1.848 N Arnt2 n/a
9 TRCN0000096381 GAATTGGATCAAGCCACCCTT pLKO.1 1796 CDS 100% 2.640 1.848 N Arnt2 n/a
10 TRCN0000374677 TGTCGGACAAGGCAGTAAATA pLKO_005 921 CDS 100% 15.000 9.000 N Arnt2 n/a
11 TRCN0000202079 CCTGTTTGTTTCACTGTGGGA pLKO.1 4897 3UTR 100% 0.660 0.330 Y Nkapl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507238.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11432 pDONR223 100% 84.7% 91.7% None (many diffs) n/a
2 ccsbBroad304_11432 pLX_304 0% 84.7% 91.7% V5 (many diffs) n/a
3 TRCN0000479506 GTGGTCCAAAGACGCTATTCAGCC pLX_317 13.6% 84.7% 91.7% V5 (many diffs) n/a
Download CSV