Transcript: Mouse XM_006508798.1

PREDICTED: Mus musculus tubulin, gamma complex associated protein 3 (Tubgcp3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tubgcp3 (259279)
Length:
3867
CDS:
214..3006

Additional Resources:

NCBI RefSeq record:
XM_006508798.1
NBCI Gene record:
Tubgcp3 (259279)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434508 CCGTGACGCTGCGGATTTATT pLKO_005 1755 CDS 100% 15.000 21.000 N Tubgcp3 n/a
2 TRCN0000091981 GCTGCTCTTGTGAGAGATATT pLKO.1 949 CDS 100% 13.200 10.560 N Tubgcp3 n/a
3 TRCN0000091978 GCATTCTCTGTGAGACAGTTT pLKO.1 3334 3UTR 100% 4.950 3.960 N Tubgcp3 n/a
4 TRCN0000435606 AGGAGTCTGGACCGCTCATTT pLKO_005 1138 CDS 100% 13.200 9.240 N Tubgcp3 n/a
5 TRCN0000091982 CCACTACCTGAGAGTGTTTAA pLKO.1 2181 CDS 100% 13.200 9.240 N Tubgcp3 n/a
6 TRCN0000091980 GAGGACACTTACCACGAATTT pLKO.1 1525 CDS 100% 13.200 9.240 N Tubgcp3 n/a
7 TRCN0000424361 GTCTATGGCACGACAAGTATA pLKO_005 1580 CDS 100% 13.200 9.240 N Tubgcp3 n/a
8 TRCN0000091979 GCCGTGTTTGACCAAATCATT pLKO.1 2611 CDS 100% 5.625 3.938 N Tubgcp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11497 pDONR223 100% 75.2% 81.9% None (many diffs) n/a
2 ccsbBroad304_11497 pLX_304 0% 75.2% 81.9% V5 (many diffs) n/a
3 TRCN0000479745 TACCAATGGACGCTCGAGTAGTCT pLX_317 14.4% 75.2% 81.9% V5 (many diffs) n/a
Download CSV