Transcript: Mouse XM_006510878.2

PREDICTED: Mus musculus RAR-related orphan receptor alpha (Rora), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rora (19883)
Length:
10728
CDS:
16..1443

Additional Resources:

NCBI RefSeq record:
XM_006510878.2
NBCI Gene record:
Rora (19883)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222416 CCGAAGACGAAATCGCGTTAT pLKO.1 1118 CDS 100% 10.800 15.120 N Rora n/a
2 TRCN0000022155 CCAAACGCATTGATGGATTTA pLKO.1 884 CDS 100% 13.200 9.240 N RORA n/a
3 TRCN0000022157 GAATCCATTATGGTGTCATTA pLKO.1 116 CDS 100% 13.200 9.240 N RORA n/a
4 TRCN0000222420 CAGTCGGGATTGGACATCAAT pLKO.1 562 CDS 100% 5.625 3.938 N Rora n/a
5 TRCN0000055024 CAGACATTGTGCGACTCCATT pLKO.1 1358 CDS 100% 4.950 3.465 N Rora n/a
6 TRCN0000055023 CTTGCCCAGAACATATCCAAA pLKO.1 697 CDS 100% 4.950 3.465 N Rora n/a
7 TRCN0000222418 CTACAGAAGAACCACCGAGAA pLKO.1 1240 CDS 100% 4.050 2.835 N Rora n/a
8 TRCN0000055026 TGTCTACGTTAAGAGCCCTAT pLKO.1 1292 CDS 100% 4.050 2.835 N Rora n/a
9 TRCN0000222417 CCATCAAGATTACAGAAGCTA pLKO.1 842 CDS 100% 3.000 2.100 N Rora n/a
10 TRCN0000055027 GTGGAGACAAATCGTCAGGAA pLKO.1 98 CDS 100% 2.640 1.848 N Rora n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3283 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491974 CACAAGTCCTCGTCATGAGGGAAC pLX_317 17.3% 88.5% 96.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_13944 pDONR223 100% 88.5% 95.7% None (many diffs) n/a
3 ccsbBroad304_13944 pLX_304 0% 88.5% 95.7% V5 (not translated due to frame shift) (many diffs) n/a
4 TRCN0000488554 CCGGAAAGGCAAATATTAGTTTAT pLX_317 22.8% 81.9% 87.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV