Transcript: Mouse XM_006511582.2

PREDICTED: Mus musculus ring finger 111 (Rnf111), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf111 (93836)
Length:
4381
CDS:
280..3276

Additional Resources:

NCBI RefSeq record:
XM_006511582.2
NBCI Gene record:
Rnf111 (93836)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511582.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295078 AGCCAATTTCACACCATATTC pLKO_005 2450 CDS 100% 13.200 18.480 N Rnf111 n/a
2 TRCN0000039456 GCCAAGGTTCAAGTTCGCATA pLKO.1 1319 CDS 100% 4.050 5.670 N Rnf111 n/a
3 TRCN0000287658 GCCAAGGTTCAAGTTCGCATA pLKO_005 1319 CDS 100% 4.050 5.670 N Rnf111 n/a
4 TRCN0000295011 CTATCCTCACATCCGTTATAT pLKO_005 2859 CDS 100% 15.000 10.500 N Rnf111 n/a
5 TRCN0000039454 GCGTTGATGAACACTAAATAT pLKO.1 4101 3UTR 100% 15.000 10.500 N Rnf111 n/a
6 TRCN0000287656 GCGTTGATGAACACTAAATAT pLKO_005 4101 3UTR 100% 15.000 10.500 N Rnf111 n/a
7 TRCN0000039455 CGACTTCATCACCTCCAGTTA pLKO.1 2803 CDS 100% 4.950 3.465 N Rnf111 n/a
8 TRCN0000039458 GCTCAGAGGAAGTATGCTCTT pLKO.1 1003 CDS 100% 4.050 2.835 N Rnf111 n/a
9 TRCN0000287655 GCTCAGAGGAAGTATGCTCTT pLKO_005 1003 CDS 100% 4.050 2.835 N Rnf111 n/a
10 TRCN0000039457 GCCATTATCAATAGATGGCTA pLKO.1 2106 CDS 100% 0.264 0.185 N Rnf111 n/a
11 TRCN0000428624 ATGACTTACCTGCGCAGATTT pLKO_005 3349 3UTR 100% 13.200 10.560 N RNF111 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511582.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12078 pDONR223 100% 86.7% 88.7% None (many diffs) n/a
2 ccsbBroad304_12078 pLX_304 0% 86.7% 88.7% V5 (many diffs) n/a
3 TRCN0000480460 CAAGATGAATGATGGTTTCAATAT pLX_317 12.4% 86.7% 88.7% V5 (many diffs) n/a
4 ccsbBroadEn_12077 pDONR223 100% 13% 13.6% None (many diffs) n/a
5 ccsbBroad304_12077 pLX_304 0% 13% 13.6% V5 (many diffs) n/a
6 TRCN0000478704 TGACCCTCATCGTCCTTGATTTGC pLX_317 76.3% 13% 13.6% V5 (many diffs) n/a
Download CSV