Transcript: Mouse XM_006516583.3

PREDICTED: Mus musculus pre-mRNA processing factor 4B (Prpf4b), transcript variant X15, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prpf4b (19134)
Length:
3138
CDS:
361..3051

Additional Resources:

NCBI RefSeq record:
XM_006516583.3
NBCI Gene record:
Prpf4b (19134)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516583.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294535 GTCCTAGATAAACGTTATAAT pLKO_005 2404 CDS 100% 15.000 21.000 N Prpf4b n/a
2 TRCN0000025363 CCGGATAATATTCTGGTTAAT pLKO.1 2812 CDS 100% 13.200 18.480 N Prpf4b n/a
3 TRCN0000294534 TTATCGAGGCTTCCGACAAAG pLKO_005 611 CDS 100% 10.800 7.560 N Prpf4b n/a
4 TRCN0000025359 GCCAATTAAATCACCTTCAAA pLKO.1 1332 CDS 100% 5.625 3.938 N Prpf4b n/a
5 TRCN0000025361 CGGGAGAATGTTGACACCTTT pLKO.1 2149 CDS 100% 4.950 3.465 N Prpf4b n/a
6 TRCN0000025362 GCTGAGCTTGATAATGAGTTA pLKO.1 715 CDS 100% 4.950 3.465 N Prpf4b n/a
7 TRCN0000294603 GCTGAGCTTGATAATGAGTTA pLKO_005 715 CDS 100% 4.950 3.465 N Prpf4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516583.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492284 AATCCATTCTCGATCTTGGTCAAC pLX_317 11.2% 77.4% 79.9% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_07328 pDONR223 100% 77.2% 79.5% None (many diffs) n/a
3 ccsbBroad304_07328 pLX_304 0% 77.2% 79.5% V5 (many diffs) n/a
4 TRCN0000477049 GATGGTCCCCGTGCCAATGTATCA pLX_317 12.4% 77.2% 79.5% V5 (many diffs) n/a
5 ccsbBroadEn_14919 pDONR223 52.4% 77.1% 26% None (many diffs) n/a
6 ccsbBroad304_14919 pLX_304 0% 77.1% 26% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000470684 TTAGATAGTCGATTAGTACGTATA pLX_317 12.4% 77.1% 26% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV