Transcript: Mouse XM_006517150.3

PREDICTED: Mus musculus neurotrophic tyrosine kinase, receptor, type 2 (Ntrk2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ntrk2 (18212)
Length:
8066
CDS:
754..2364

Additional Resources:

NCBI RefSeq record:
XM_006517150.3
NBCI Gene record:
Ntrk2 (18212)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023700 CCTTAAGGATAACGAACATTT pLKO.1 1499 CDS 100% 13.200 18.480 N Ntrk2 n/a
2 TRCN0000023699 CCGGCTTAAAGTTTGTGGCTT pLKO.1 1055 CDS 100% 2.640 3.696 N Ntrk2 n/a
3 TRCN0000361390 CAGCAACCTGCGGCACATAAA pLKO_005 1095 CDS 100% 13.200 9.240 N Ntrk2 n/a
4 TRCN0000023703 CATTCCAAGTTTGGCATGAAA pLKO.1 2125 CDS 100% 5.625 3.938 N Ntrk2 n/a
5 TRCN0000023701 CCACGGATGTTGCTGACCAAA pLKO.1 2006 CDS 100% 4.950 3.465 N Ntrk2 n/a
6 TRCN0000023702 GCTTACAAAGCGTTTCTGAAA pLKO.1 1072 CDS 100% 4.950 3.465 N Ntrk2 n/a
7 TRCN0000361389 CCGGAGAACATCACGGAAATT pLKO_005 946 CDS 100% 13.200 7.920 N Ntrk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01113 pDONR223 100% 76.1% 77% None (many diffs) n/a
2 ccsbBroad304_01113 pLX_304 0% 76.1% 77% V5 (many diffs) n/a
3 ccsbBroadEn_14721 pDONR223 0% 56.3% 58.3% None (many diffs) n/a
4 ccsbBroad304_14721 pLX_304 0% 56.3% 58.3% V5 (many diffs) n/a
5 TRCN0000480309 ACAATAAGTGTCCCAGTTAAGTTT pLX_317 14.3% 56.3% 58.3% V5 (many diffs) n/a
6 TRCN0000488063 CTCACTGTCGAGCAACCATACTGA pLX_317 13% 56.3% 58.3% V5 (many diffs) n/a
7 TRCN0000488161 TATCAGACTTTGGGGGGGCAAAAC pLX_317 12.7% 56.3% 58.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV