Transcript: Mouse XM_006518565.3

PREDICTED: Mus musculus glutamate receptor, ionotropic, delta 1 (Grid1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grid1 (14803)
Length:
5547
CDS:
225..2969

Additional Resources:

NCBI RefSeq record:
XM_006518565.3
NBCI Gene record:
Grid1 (14803)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518565.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103041 CGTGCTCATATTCGTGTTGAA pLKO.1 1670 CDS 100% 4.950 3.960 N Grid1 n/a
2 TRCN0000103042 GTGCTCATATTCGTGTTGAAT pLKO.1 1671 CDS 100% 5.625 3.938 N Grid1 n/a
3 TRCN0000103043 CGTTACAAAGGGTTCTCCATA pLKO.1 1323 CDS 100% 4.950 3.465 N Grid1 n/a
4 TRCN0000103040 GCTGAGAATATCCTTGGACAA pLKO.1 1296 CDS 100% 4.050 2.835 N Grid1 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3053 3UTR 100% 4.950 2.475 Y KAAG1 n/a
6 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 3081 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518565.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13863 pDONR223 100% 46.1% 50.4% None (many diffs) n/a
2 ccsbBroad304_13863 pLX_304 0% 46.1% 50.4% V5 (many diffs) n/a
3 TRCN0000471140 AGGCCAAGTCGTGTTGCGCGTACC pLX_317 18.4% 46.1% 50.4% V5 (many diffs) n/a
4 ccsbBroadEn_10861 pDONR223 100% 12.9% 13.7% None (many diffs) n/a
5 ccsbBroad304_10861 pLX_304 0% 12.9% 13.7% V5 (many diffs) n/a
6 TRCN0000467504 GGTCGTTCCCTAAGCAGGAAGAAT pLX_317 95.1% 12.9% 13.7% V5 (many diffs) n/a
Download CSV