Transcript: Mouse XM_006520762.3

PREDICTED: Mus musculus family with sequence similarity 49, member B (Fam49b), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam49b (223601)
Length:
2041
CDS:
393..1367

Additional Resources:

NCBI RefSeq record:
XM_006520762.3
NBCI Gene record:
Fam49b (223601)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215605 GAGTCGTATGAGAATTAATAA pLKO.1 881 CDS 100% 15.000 21.000 N Fam49b n/a
2 TRCN0000172577 GATGAGACTACCTCCAAGCAA pLKO.1 1326 CDS 100% 3.000 4.200 N FAM49B n/a
3 TRCN0000264757 ATTGAGTCGTATGAGAATTAA pLKO_005 878 CDS 100% 15.000 12.000 N Fam49b n/a
4 TRCN0000264756 TAATGGTGGGTGTCATAATAC pLKO_005 1159 CDS 100% 13.200 10.560 N Fam49b n/a
5 TRCN0000193059 CCTTAAGTGATGCAACAACAA pLKO.1 991 CDS 100% 4.950 3.960 N Fam49b n/a
6 TRCN0000430901 ACTGCCTATTCTGCTATTTAA pLKO_005 1727 3UTR 100% 15.000 10.500 N FAM49B n/a
7 TRCN0000215668 GAGTCTGAGAAGGAAATATAT pLKO.1 480 CDS 100% 15.000 10.500 N Fam49b n/a
8 TRCN0000264755 GCCATCTAAGGCAGCTAATTA pLKO_005 1593 3UTR 100% 15.000 10.500 N Fam49b n/a
9 TRCN0000264754 CCGGAATACAGAAGCAGATTT pLKO_005 1104 CDS 100% 13.200 9.240 N Fam49b n/a
10 TRCN0000264758 ATTGATATGAAAGGTTGTATC pLKO_005 1227 CDS 100% 10.800 7.560 N Fam49b n/a
11 TRCN0000420983 ATTGATATGAAAGGTTGTATC pLKO_005 1227 CDS 100% 10.800 7.560 N FAM49B n/a
12 TRCN0000172477 CCACGAAATACGAGAGGCAAT pLKO.1 572 CDS 100% 4.050 2.835 N FAM49B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08323 pDONR223 100% 91.8% 96.2% None (many diffs) n/a
2 ccsbBroad304_08323 pLX_304 0% 91.8% 96.2% V5 (many diffs) n/a
3 TRCN0000472493 CGATGCATGTAAAACTTTATGGAA pLX_317 47% 91.8% 96.2% V5 (many diffs) n/a
4 ccsbBroadEn_03336 pDONR223 100% 91.8% 96.6% None (many diffs) n/a
5 ccsbBroad304_03336 pLX_304 0% 91.8% 96.6% V5 (many diffs) n/a
6 TRCN0000471959 TCGTCTAGCGGCAGCCCGTTTCCC pLX_317 38.5% 91.8% 96.6% V5 (many diffs) n/a
Download CSV