Transcript: Mouse XM_006529356.3

PREDICTED: Mus musculus dual serine/threonine and tyrosine protein kinase (Dstyk), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dstyk (213452)
Length:
5819
CDS:
1112..3601

Additional Resources:

NCBI RefSeq record:
XM_006529356.3
NBCI Gene record:
Dstyk (213452)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529356.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088494 CCGGTCTTTACAGGATGTCTT pLKO.1 2731 CDS 100% 4.950 6.930 N Dstyk n/a
2 TRCN0000288101 CCGGTCTTTACAGGATGTCTT pLKO_005 2731 CDS 100% 4.950 6.930 N Dstyk n/a
3 TRCN0000295440 TCCAGATTGTATGGTCATAAA pLKO_005 3983 3UTR 100% 13.200 9.240 N Dstyk n/a
4 TRCN0000088496 GCAAAGACCATCTCTGGAATA pLKO.1 3381 CDS 100% 10.800 7.560 N Dstyk n/a
5 TRCN0000288040 GCAAAGACCATCTCTGGAATA pLKO_005 3381 CDS 100% 10.800 7.560 N Dstyk n/a
6 TRCN0000088497 GCAAGAGGAAATGAAGGATAT pLKO.1 2047 CDS 100% 10.800 7.560 N Dstyk n/a
7 TRCN0000288103 GCAAGAGGAAATGAAGGATAT pLKO_005 2047 CDS 100% 10.800 7.560 N Dstyk n/a
8 TRCN0000088493 CCACTTAGAAACATGACCTTA pLKO.1 3960 3UTR 100% 4.950 3.465 N Dstyk n/a
9 TRCN0000088495 CCTGTGATAACCTATGCACTT pLKO.1 1553 CDS 100% 4.050 2.835 N Dstyk n/a
10 TRCN0000288104 CCTGTGATAACCTATGCACTT pLKO_005 1553 CDS 100% 4.050 2.835 N Dstyk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529356.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15025 pDONR223 95.5% 78.8% 82.3% None (many diffs) n/a
2 ccsbBroadEn_15768 pDONR223 0% 74.7% 77.9% None (many diffs) n/a
3 ccsbBroad304_15768 pLX_304 0% 74.7% 77.9% V5 (many diffs) n/a
4 ccsbBroadEn_15026 pDONR223 0% 74.7% 77.9% None (many diffs) n/a
5 ccsbBroad304_15026 pLX_304 0% 74.7% 77.9% V5 (many diffs) n/a
6 TRCN0000474096 CAAAGCTTAGATGTAGCCTTTTTC pLX_317 17.6% 74.7% 77.9% V5 (many diffs) n/a
7 TRCN0000491323 AAGTAGCCCTTGGGAAGAAAGCCG pLX_317 15.4% 74.7% 77.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV