Transcript: Mouse XM_006532568.3

PREDICTED: Mus musculus Rap guanine nucleotide exchange factor (GEF) 6 (Rapgef6), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rapgef6 (192786)
Length:
9190
CDS:
4529..8755

Additional Resources:

NCBI RefSeq record:
XM_006532568.3
NBCI Gene record:
Rapgef6 (192786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532568.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178091 GCTTGACTCATGGTATGTCAT pLKO.1 5470 CDS 100% 4.950 6.930 N Rapgef6 n/a
2 TRCN0000346973 GCTTGACTCATGGTATGTCAT pLKO_005 5470 CDS 100% 4.950 6.930 N Rapgef6 n/a
3 TRCN0000177591 CGAGAATGCAAGAATTTCAAT pLKO.1 7352 CDS 100% 5.625 4.500 N Rapgef6 n/a
4 TRCN0000346902 CGAGAATGCAAGAATTTCAAT pLKO_005 7352 CDS 100% 5.625 4.500 N Rapgef6 n/a
5 TRCN0000177845 CGGATTGTACTCTTATGGGTA pLKO.1 5954 CDS 100% 2.640 2.112 N Rapgef6 n/a
6 TRCN0000346974 CGGATTGTACTCTTATGGGTA pLKO_005 5954 CDS 100% 2.640 2.112 N Rapgef6 n/a
7 TRCN0000047143 GCCTCCAATTATTCCACTCTT pLKO.1 7546 CDS 100% 4.950 3.465 N RAPGEF6 n/a
8 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 5225 CDS 100% 4.950 2.475 Y PTMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532568.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08342 pDONR223 100% 80.4% 78.5% None (many diffs) n/a
2 ccsbBroad304_08342 pLX_304 0% 80.4% 78.5% V5 (many diffs) n/a
3 TRCN0000481587 CCCCTTCTTGCTCGCATTGACCTG pLX_317 10.9% 80.4% 78.5% V5 (many diffs) n/a
Download CSV