Transcript: Mouse XM_006535804.3

PREDICTED: Mus musculus putative homeodomain transcription factor 2 (Phtf2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phtf2 (68770)
Length:
1323
CDS:
200..1222

Additional Resources:

NCBI RefSeq record:
XM_006535804.3
NBCI Gene record:
Phtf2 (68770)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535804.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374258 TGAAGTGATTGGGCCAATATG pLKO_005 586 CDS 100% 13.200 10.560 N Phtf2 n/a
2 TRCN0000366042 ATAGAAAGCCACACCATTATA pLKO_005 1164 CDS 100% 15.000 10.500 N Phtf2 n/a
3 TRCN0000085757 CGGTTCTAGCACCACAGATAA pLKO.1 742 CDS 100% 13.200 9.240 N Phtf2 n/a
4 TRCN0000085754 GCCAGATTGTTTCAACAAGAA pLKO.1 636 CDS 100% 4.950 3.465 N Phtf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535804.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15941 pDONR223 0% 84.5% 85.5% None (many diffs) n/a
2 ccsbBroad304_15941 pLX_304 0% 84.5% 85.5% V5 (many diffs) n/a
3 TRCN0000472805 ATACAAACACTAAGAAAAATGACC pLX_317 21% 84.5% 85.5% V5 (many diffs) n/a
4 ccsbBroadEn_15940 pDONR223 0% 83.6% 84.5% None (many diffs) n/a
5 ccsbBroad304_15940 pLX_304 0% 83.6% 84.5% V5 (many diffs) n/a
6 TRCN0000465978 CCCTACCGTCAGTTCATCCGTGCG pLX_317 32.7% 83.6% 84.5% V5 (many diffs) n/a
7 ccsbBroadEn_03798 pDONR223 100% 40.2% 40% None (many diffs) n/a
8 ccsbBroad304_03798 pLX_304 0% 40.2% 40% V5 (many diffs) n/a
9 TRCN0000474694 TTCCGATACCCTGCCCGTAGGATC pLX_317 19.9% 40.2% 40% V5 (many diffs) n/a
10 ccsbBroadEn_15939 pDONR223 0% 38.8% 37.4% None (many diffs) n/a
11 ccsbBroad304_15939 pLX_304 0% 38.8% 37.4% V5 (many diffs) n/a
12 TRCN0000468673 ATTCAATCCGCAACACTGGTATCC pLX_317 48.1% 38.8% 37.4% V5 (many diffs) n/a
Download CSV