Transcript: Mouse XM_006538374.1

PREDICTED: Mus musculus ADAMTS-like 1 (Adamtsl1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adamtsl1 (77739)
Length:
10689
CDS:
787..6789

Additional Resources:

NCBI RefSeq record:
XM_006538374.1
NBCI Gene record:
Adamtsl1 (77739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080462 GAGGAGTGAATGTGACAATTA pLKO.1 5372 CDS 100% 13.200 10.560 N Adamtsl1 n/a
2 TRCN0000080460 CGAGGAGTGAATGTGACAATT pLKO.1 5371 CDS 100% 13.200 9.240 N Adamtsl1 n/a
3 TRCN0000080458 GCCTGGAAGTTAAGTTTGAAA pLKO.1 9889 3UTR 100% 5.625 3.938 N Adamtsl1 n/a
4 TRCN0000080461 GCAACGTCACTCCATGTGAAA pLKO.1 6656 CDS 100% 4.950 3.465 N Adamtsl1 n/a
5 TRCN0000080459 GCCAGATGATTCCTTACAGAT pLKO.1 5163 CDS 100% 4.950 3.465 N Adamtsl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16067 pDONR223 0% 19.2% 19.9% None (many diffs) n/a
2 ccsbBroad304_16067 pLX_304 0% 19.2% 19.9% V5 (many diffs) n/a
3 TRCN0000465309 ATGAAACTCTTAGAACAAGTGTAC pLX_317 24.1% 19.2% 19.9% V5 (many diffs) n/a
4 ccsbBroadEn_12984 pDONR223 100% 19% 19.2% None (many diffs) n/a
5 ccsbBroad304_12984 pLX_304 0% 19% 19.2% V5 (many diffs) n/a
6 TRCN0000469304 CTCCTGCAATCATGGACCCCAGTC pLX_317 27.8% 19% 19.2% V5 (many diffs) n/a
Download CSV