Transcript: Mouse XM_006539444.1

PREDICTED: Mus musculus protein kinase D2 (Prkd2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prkd2 (101540)
Length:
2087
CDS:
92..1741

Additional Resources:

NCBI RefSeq record:
XM_006539444.1
NBCI Gene record:
Prkd2 (101540)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350724 GAAAGATGGGCGAGCGATATA pLKO_005 1578 CDS 100% 13.200 18.480 N Prkd2 n/a
2 TRCN0000199598 GCTCGCATCATCGGCGAGAAG pLKO.1 1211 CDS 100% 0.000 0.000 N PRKD2 n/a
3 TRCN0000322347 CCTCAACCTTGGAGCGATAAG pLKO_005 1891 3UTR 100% 10.800 7.560 N Prkd2 n/a
4 TRCN0000322281 CGGCCAATGTCACCTACTTTG pLKO_005 528 CDS 100% 10.800 7.560 N Prkd2 n/a
5 TRCN0000024325 CCAACAGATACTACAAGGAAA pLKO.1 417 CDS 100% 4.950 3.465 N Prkd2 n/a
6 TRCN0000024327 GCAGTAAAGGTCATTGACAAA pLKO.1 848 CDS 100% 4.950 3.465 N Prkd2 n/a
7 TRCN0000024326 CGACCTCATCAACAACCTGTT pLKO.1 1459 CDS 100% 4.050 2.835 N Prkd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489157 CTATACTAGACCGTTATTCTAATG pLX_317 21.4% 85.8% 92% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489002 TGTACTAACTGGCCAATTCCGCAC pLX_317 15.1% 55.4% 59.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_15028 pDONR223 59.1% 55.2% 11.1% None (many diffs) n/a
4 ccsbBroad304_15028 pLX_304 0% 55.2% 11.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000473412 CTACGTAAAGGCGACCATTCGTTG pLX_317 15% 55.2% 11.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV