Transcript: Human XM_006715553.3

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 7 (MAP3K7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K7 (6885)
Length:
4948
CDS:
596..2026

Additional Resources:

NCBI RefSeq record:
XM_006715553.3
NBCI Gene record:
MAP3K7 (6885)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148226 CACACATGACCAATAACAAG pXPR_003 GGG 177 12% 4 0.1458 MAP3K7 MAP3K7 75694
2 BRDN0001145981 CCCAGCTTTCCGAATCATGT pXPR_003 GGG 328 23% 5 0.0641 MAP3K7 MAP3K7 75692
3 BRDN0001148020 ACCCAAAGCGCTAATTCACA pXPR_003 GGG 70 5% 3 -0.2434 MAP3K7 MAP3K7 75693
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001555 CCCGTGTGAACCATCCTAATA pLKO.1 430 5UTR 100% 13.200 18.480 N MAP3K7 n/a
2 TRCN0000001557 GACACACATGACCAATAACAA pLKO.1 754 CDS 100% 5.625 7.875 N MAP3K7 n/a
3 TRCN0000195533 CGGAACCTTTAGGGATAGTTC pLKO.1 2528 3UTR 100% 4.950 6.930 N MAP3K7 n/a
4 TRCN0000022560 CGCCCTTCAATGGAGGAAATT pLKO.1 1025 CDS 100% 13.200 9.240 N Map3k7 n/a
5 TRCN0000322345 CGCCCTTCAATGGAGGAAATT pLKO_005 1025 CDS 100% 13.200 9.240 N Map3k7 n/a
6 TRCN0000195493 CATCCCAATGGCTTATCTTAC pLKO.1 1690 CDS 100% 10.800 7.560 N MAP3K7 n/a
7 TRCN0000196674 GCTTCTACAAATACGAGTAAC pLKO.1 1172 CDS 100% 10.800 7.560 N MAP3K7 n/a
8 TRCN0000001554 GCAGTGATTCTTGGATTGTTT pLKO.1 2860 3UTR 100% 5.625 3.938 N MAP3K7 n/a
9 TRCN0000001558 TCCTGCCACAAATGATACTAT pLKO.1 1219 CDS 100% 5.625 3.938 N MAP3K7 n/a
10 TRCN0000022559 AGGCAAAGCAACAGAGTGAAT pLKO.1 1272 CDS 100% 4.950 3.465 N Map3k7 n/a
11 TRCN0000322277 AGGCAAAGCAACAGAGTGAAT pLKO_005 1272 CDS 100% 4.950 3.465 N Map3k7 n/a
12 TRCN0000001556 CAGTGTGTCTTGTGATGGAAT pLKO.1 481 5UTR 100% 4.950 3.465 N MAP3K7 n/a
13 TRCN0000195532 CCATCCAAGACTTGACTGTAA pLKO.1 1521 CDS 100% 4.950 3.465 N MAP3K7 n/a
14 TRCN0000195383 CGGAAACCCTTTGATGAGATT pLKO.1 881 CDS 100% 4.950 3.465 N MAP3K7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14856 pDONR223 0% 74% 74% None 0_1ins390;818_898del n/a
2 ccsbBroad304_14856 pLX_304 39% 74% 74% V5 (not translated due to frame shift) 0_1ins390;818_898del n/a
3 TRCN0000473540 CTTAATAACGAGGATTAACAACGT pLX_317 27.1% 74% 74% V5 (not translated due to frame shift) 0_1ins390;818_898del n/a
4 TRCN0000488462 TTCAGTCTCGCGCTAGGCGCCATT pLX_317 18.3% 74% 74% V5 (not translated due to prior stop codon) 0_1ins390;818_898del n/a
5 TRCN0000489475 TTACTCACCAATTCGGAAGAAGGT pLX_317 25.4% 59.5% 57.9% V5 (many diffs) n/a
6 TRCN0000488961 GTCGGACGCGGTCTCTGATGACCG pLX_317 24.6% 59.5% 57.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV