Transcript: Human XM_006724901.3

PREDICTED: Homo sapiens POTE ankyrin domain family member B-like (LOC102723502), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC102723502 (102723502)
Length:
1406
CDS:
148..1302

Additional Resources:

NCBI RefSeq record:
XM_006724901.3
NBCI Gene record:
LOC102723502 (102723502)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724901.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142532 GCCAAAGCACTGCTCTTATAT pLKO.1 910 CDS 100% 15.000 7.500 Y POTEE n/a
2 TRCN0000145382 GCTCTTATATGGTGCTGATAT pLKO.1 921 CDS 100% 13.200 6.600 Y POTEE n/a
3 TRCN0000148072 GCTCTTATATGGTGCTGATAT pLKO.1 921 CDS 100% 13.200 6.600 Y POTED n/a
4 TRCN0000265540 GGACAGACGATGTCAACTTAA pLKO_005 726 CDS 100% 13.200 6.600 Y POTEC n/a
5 TRCN0000254474 TCTTATATGGTGCTGATATTG pLKO_005 923 CDS 100% 13.200 6.600 Y POTEC n/a
6 TRCN0000421750 GACAGACGATGTCAACTTAAC pLKO_005 727 CDS 100% 10.800 5.400 Y POTEB3 n/a
7 TRCN0000436448 GTTGTGGATCAGCAAGTATAG pLKO_005 1088 CDS 100% 10.800 5.400 Y POTEB3 n/a
8 TRCN0000418180 TCTGATAAAGGCCGTACAATG pLKO_005 774 CDS 100% 10.800 5.400 Y POTEB3 n/a
9 TRCN0000435056 TGTATCTTCTCAAGATCTATC pLKO_005 1137 CDS 100% 10.800 5.400 Y POTEB3 n/a
10 TRCN0000146483 CCAGAGAGTATGCTGTTTCTA pLKO.1 1169 CDS 100% 5.625 2.813 Y POTED n/a
11 TRCN0000155986 CCAGAGAGTATGCTGTTTCTA pLKO.1 1169 CDS 100% 5.625 2.813 Y POTEG n/a
12 TRCN0000146680 CCATGACAACTCCTTTATGAA pLKO.1 402 CDS 100% 5.625 2.813 Y POTEB3 n/a
13 TRCN0000179550 GCTGTGAAGAAGCCATTTGAT pLKO.1 184 CDS 100% 5.625 2.813 Y POTEB3 n/a
14 TRCN0000146288 CAGGAAGATGAATGTGTGTTA pLKO.1 796 CDS 100% 4.950 2.475 Y POTED n/a
15 TRCN0000156427 CCGCTCTACACTATGCTATCT pLKO.1 869 CDS 100% 4.950 2.475 Y POTEH n/a
16 TRCN0000140774 GAAGACACTCAGGAGCAAGAT pLKO.1 420 CDS 100% 4.950 2.475 Y POTEE n/a
17 TRCN0000157596 GAAGACACTCAGGAGCAAGAT pLKO.1 420 CDS 100% 4.950 2.475 Y POTEH n/a
18 TRCN0000144603 GAGTATGCTGTTTCTAGTCAT pLKO.1 1174 CDS 100% 4.950 2.475 Y POTEE n/a
19 TRCN0000148154 GCCAATGGAAATTCAGAAGTA pLKO.1 691 CDS 100% 4.950 2.475 Y POTED n/a
20 TRCN0000140286 GCTCTGATAAAGGCCGTACAA pLKO.1 772 CDS 100% 4.950 2.475 Y POTEE n/a
21 TRCN0000154872 CAGAAAGGATCTCATCGTCAT pLKO.1 606 CDS 100% 4.050 2.025 Y POTEH n/a
22 TRCN0000146454 CTGCTCTTATATGGTGCTGAT pLKO.1 919 CDS 100% 4.050 2.025 Y POTED n/a
23 TRCN0000154544 GAGTATGGAAATACCGCTCTA pLKO.1 856 CDS 100% 4.050 2.025 Y POTEH n/a
24 TRCN0000150127 CAACTCCTTTATGAAGACACT pLKO.1 408 CDS 100% 2.640 1.320 Y POTEB3 n/a
25 TRCN0000179963 CCTTTATGAAGACACTCAGGA pLKO.1 413 CDS 100% 2.640 1.320 Y POTEB3 n/a
26 TRCN0000262860 GACAGACGATGTCAACTTAAT pLKO_005 727 CDS 100% 13.200 6.600 Y POTEF n/a
27 TRCN0000148413 CGACGACTCCTTTATGAAGAT pLKO.1 294 CDS 100% 4.950 2.475 Y POTED n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724901.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16159 pDONR223 0% 98.4% 97.3% None (many diffs) n/a
2 ccsbBroad304_16159 pLX_304 0% 98.4% 97.3% V5 (many diffs) n/a
3 TRCN0000481035 CTCACAAGTATCCACCTTTAGCGG pLX_317 40.3% 98.4% 97.3% V5 (many diffs) n/a
4 ccsbBroadEn_13645 pDONR223 100% 96.7% 94.5% None (many diffs) n/a
5 ccsbBroad304_13645 pLX_304 0% 96.7% 94.5% V5 (many diffs) n/a
6 TRCN0000475599 CTACCGATTGCATGCTTACATGGA pLX_317 15.6% 96.7% 94.5% V5 (many diffs) n/a
7 ccsbBroadEn_10007 pDONR223 100% 65.9% 64.5% None (many diffs) n/a
8 ccsbBroad304_10007 pLX_304 0% 65.9% 64.5% V5 (many diffs) n/a
9 TRCN0000470029 CGGTCGAATCTTAACATCGCAATG pLX_317 21.7% 65.9% 64.5% V5 (many diffs) n/a
Download CSV