Transcript: Mouse XM_011243746.1

PREDICTED: Mus musculus pellino 1 (Peli1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Peli1 (67245)
Length:
3016
CDS:
154..1212

Additional Resources:

NCBI RefSeq record:
XM_011243746.1
NBCI Gene record:
Peli1 (67245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243746.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077352 GCGAACTCATTGTCTTAGGAT pLKO.1 206 CDS 100% 3.000 4.200 N Peli1 n/a
2 TRCN0000312755 CAGGACTGCATTGTAAGTTTA pLKO_005 1224 3UTR 100% 13.200 10.560 N Peli1 n/a
3 TRCN0000077348 GCTCCTTTGAATATGCAATTT pLKO.1 1958 3UTR 100% 13.200 10.560 N Peli1 n/a
4 TRCN0000077350 GCTTTAAGACAGGAGATCAAT pLKO.1 763 CDS 100% 5.625 4.500 N Peli1 n/a
5 TRCN0000311836 GCTTTAAGACAGGAGATCAAT pLKO_005 763 CDS 100% 5.625 4.500 N Peli1 n/a
6 TRCN0000312817 ACTCATTGTCTTAGGATATAA pLKO_005 210 CDS 100% 15.000 10.500 N Peli1 n/a
7 TRCN0000077351 CAAGGCTATATCAGACTTATT pLKO.1 1171 CDS 100% 13.200 9.240 N Peli1 n/a
8 TRCN0000420488 GACCAGCATAGCATATCATAT pLKO_005 370 CDS 100% 13.200 9.240 N PELI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243746.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08714 pDONR223 100% 78.4% 84.2% None (many diffs) n/a
2 ccsbBroad304_08714 pLX_304 0% 78.4% 84.2% V5 (many diffs) n/a
3 TRCN0000478265 GCACACGGTGTACATGGGCGCGGA pLX_317 17.5% 78.4% 84.2% V5 (many diffs) n/a
4 ccsbBroadEn_15942 pDONR223 0% 33.4% 35.5% None (many diffs) n/a
5 ccsbBroad304_15942 pLX_304 0% 33.4% 35.5% V5 (many diffs) n/a
6 TRCN0000474918 GTACTAACTACGACCGGACATTTC pLX_317 100% 33.4% 35.5% V5 (many diffs) n/a
Download CSV