Transcript: Mouse XM_011250518.2

PREDICTED: Mus musculus ATPase, Na+/K+ transporting, alpha 3 polypeptide (Atp1a3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp1a3 (232975)
Length:
3544
CDS:
177..3377

Additional Resources:

NCBI RefSeq record:
XM_011250518.2
NBCI Gene record:
Atp1a3 (232975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250518.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313095 AGAAGAGGTCTGCCGGAAATA pLKO_005 329 CDS 100% 13.200 9.240 N Atp1a3 n/a
2 TRCN0000101782 GCTGGGTTTCTGCCATTACTA pLKO.1 1841 CDS 100% 5.625 3.938 N Atp1a3 n/a
3 TRCN0000101781 CGCACTGTCAATGACCTAGAA pLKO.1 2862 CDS 100% 4.950 3.465 N Atp1a3 n/a
4 TRCN0000349363 CGCACTGTCAATGACCTAGAA pLKO_005 2862 CDS 100% 4.950 3.465 N Atp1a3 n/a
5 TRCN0000101783 GAGCACAAGATGTCAGTAGAA pLKO.1 312 CDS 100% 4.950 3.465 N Atp1a3 n/a
6 TRCN0000101784 CCTCTCTCTCATTCTGGGTTA pLKO.1 1109 CDS 100% 4.050 2.835 N Atp1a3 n/a
7 TRCN0000349819 TATGGGCAGCAGTGGACTTAT pLKO_005 2889 CDS 100% 13.200 7.920 N Atp1a3 n/a
8 TRCN0000349864 CGGAGCAGATTGACGAGATTC pLKO_005 2209 CDS 100% 10.800 6.480 N Atp1a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250518.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05865 pDONR223 100% 86.1% 93.9% None (many diffs) n/a
2 ccsbBroad304_05865 pLX_304 0% 86.1% 93.9% V5 (many diffs) n/a
3 TRCN0000466545 AATTCATCGCCTCCCAAGTTGATG pLX_317 12.6% 86.1% 93.9% V5 (many diffs) n/a
4 ccsbBroadEn_05864 pDONR223 100% 77.5% 82.9% None (many diffs) n/a
Download CSV