Transcript: Human XM_011513562.3

PREDICTED: Homo sapiens zinc finger protein 141 (ZNF141), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF141 (7700)
Length:
5638
CDS:
921..2429

Additional Resources:

NCBI RefSeq record:
XM_011513562.3
NBCI Gene record:
ZNF141 (7700)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012928 CCGGTGAATAAACATAAGAAA pLKO.1 2733 3UTR 100% 5.625 7.875 N ZNF141 n/a
2 TRCN0000012932 GATCGGAGTCAACATAAGAAA pLKO.1 2229 CDS 100% 5.625 7.875 N ZNF141 n/a
3 TRCN0000012929 CGGTTCTCACACCTGAATAAA pLKO.1 2388 CDS 100% 15.000 10.500 N ZNF141 n/a
4 TRCN0000418631 AGGGTCCTGAATGAACATAAA pLKO_005 2142 CDS 100% 13.200 9.240 N ZNF141 n/a
5 TRCN0000421715 TCACACTTTGCTAAGCATAAA pLKO_005 1722 CDS 100% 13.200 9.240 N ZNF141 n/a
6 TRCN0000012930 GCTCCTGAGTCAACATAAGAA pLKO.1 2312 CDS 100% 5.625 3.938 N ZNF141 n/a
7 TRCN0000428825 CCTAACTCAACATAAGGTAAT pLKO_005 1559 CDS 100% 10.800 6.480 N ZNF141 n/a
8 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1921 CDS 100% 13.200 6.600 Y Zfp934 n/a
9 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1921 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
10 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1921 CDS 100% 13.200 6.600 Y EG668616 n/a
11 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 1117 CDS 100% 5.625 2.813 Y ZNF765 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000478123 AGAAGATGTATCCTCCGGGTTGTT pLX_317 11.6% 82.7% 82.3% V5 (many diffs) n/a
2 ccsbBroadEn_14883 pDONR223 94% 82.6% 82.2% None (many diffs) n/a
3 ccsbBroad304_14883 pLX_304 0% 82.6% 82.2% V5 (many diffs) n/a
4 ccsbBroadEn_09689 pDONR223 100% 54% 46.2% None (many diffs) n/a
5 ccsbBroad304_09689 pLX_304 0% 54% 46.2% V5 (many diffs) n/a
6 TRCN0000481244 ACCATTTTCTTCACCAGCCAGTGA pLX_317 14.2% 54% 46.2% V5 (many diffs) n/a
Download CSV