Transcript: Human XM_011516282.1

PREDICTED: Homo sapiens protein kinase AMP-activated non-catalytic subunit gamma 2 (PRKAG2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKAG2 (51422)
Length:
6089
CDS:
27..1871

Additional Resources:

NCBI RefSeq record:
XM_011516282.1
NBCI Gene record:
PRKAG2 (51422)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149343 AGGAGTATACAGCATCGAAG pXPR_003 AGG 1097 59% 11 0.7706 PRKAG2 PRKAG2 77462
2 BRDN0001147689 TGGCGCTGCTCGGACACCGT pXPR_003 TGG 883 48% 7 0.6426 PRKAG2 PRKAG2 77461
3 BRDN0001145518 ACTGAAGCTCATGCGTCGAG pXPR_003 GGG 343 19% 3 0.418 PRKAG2 PRKAG2 77463
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516282.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430131 ATCCACAGATTGCCCGTTATT pLKO_005 1155 CDS 100% 13.200 18.480 N PRKAG2 n/a
2 TRCN0000003145 CCTATGGTACAGATTTATGAA pLKO.1 1011 CDS 100% 5.625 4.500 N PRKAG2 n/a
3 TRCN0000433732 AGATAGTATTGTGGGTATTAT pLKO_005 1625 CDS 100% 15.000 10.500 N PRKAG2 n/a
4 TRCN0000434898 AGACTCAGAAAGTGGTGTTTA pLKO_005 773 CDS 100% 13.200 9.240 N PRKAG2 n/a
5 TRCN0000430309 ATGAGGTCACACAAGTGTTAT pLKO_005 804 CDS 100% 13.200 9.240 N PRKAG2 n/a
6 TRCN0000429506 ATTTGTGGAAAGACGAATATC pLKO_005 1364 CDS 100% 13.200 9.240 N PRKAG2 n/a
7 TRCN0000195266 CTTCACCACATCCATGAATAA pLKO.1 5657 3UTR 100% 13.200 9.240 N PRKAG2 n/a
8 TRCN0000436467 TTTGTAGGAATGCTAACAATT pLKO_005 951 CDS 100% 13.200 9.240 N PRKAG2 n/a
9 TRCN0000003148 GAAGTGCAATAAGCTGGAAAT pLKO.1 1538 CDS 100% 10.800 7.560 N PRKAG2 n/a
10 TRCN0000003146 TGGCTGCAAGTGGTTAAGAAT pLKO.1 5086 3UTR 100% 5.625 3.938 N PRKAG2 n/a
11 TRCN0000003149 TCCTATAAGCACGAGCCTGAA pLKO.1 549 CDS 100% 4.050 2.835 N PRKAG2 n/a
12 TRCN0000003147 GCCTTCATACATCCAGACACT pLKO.1 1320 CDS 100% 2.640 1.584 N PRKAG2 n/a
13 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 4510 3UTR 100% 4.950 2.475 Y n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4583 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4583 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516282.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488555 GGCGAATAATCCAGTCCTGCTCTC pLX_317 20.9% 85.7% 82.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_08289 pDONR223 100% 84.1% 83.4% None (many diffs) n/a
3 ccsbBroad304_08289 pLX_304 0% 84.1% 83.4% V5 (many diffs) n/a
4 TRCN0000470612 ACTCCGAGAATTGCACTTTTTGAA pLX_317 25.2% 84.1% 83.4% V5 (many diffs) n/a
5 ccsbBroadEn_15066 pDONR223 0% 84.1% 83.4% None (many diffs) n/a
6 ccsbBroad304_15066 pLX_304 0% 84.1% 83.4% V5 (many diffs) n/a
7 TRCN0000470682 AAGCATTACAACATGTAGGTAAAT pLX_317 27.2% 84.1% 83.4% V5 (many diffs) n/a
8 ccsbBroadEn_03303 pDONR223 100% 52.3% 51.6% None (many diffs) n/a
9 ccsbBroad304_03303 pLX_304 0% 52.3% 51.6% V5 (many diffs) n/a
10 TRCN0000473870 TCGCCAAGCTGGTAATCACGGCAG pLX_317 44.3% 52.3% 51.6% V5 (many diffs) n/a
Download CSV